Dec 1995

No. 35

ISSN : 0127 - 0265

KANDUNGAN

Laboratory safety and control of laboratory infections - Norazah A . . . . . . . . . . . . . . I

The use of polymerase chain reaction (PCK) in malaria research - Patricia LKC . . . 3

Laboratory diagnosis of parasitic diseases - Mak JW . . . . . . . . . . . . . . . . . . . . . . . . . 5

Trends in HIV testing - Mangalam S . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 9

Practical aspects of laboratory diagnosis of Dengue - Vijayamalar B . . . . . . . . . . . . . 15

Summary of 1994 antibiotic resistance surveillance results - Rohani MY . . . . . . . . 18

National Surveillance of antibiotic resistance 1994 - Rohani MY . . . . . . . . . . . . . . . 20

IMR Abstracts . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 24

Cytokines - HK Gill . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 26

MSc Thesis: Studies on alkaloids and antitumour activity of Hunteria zeylanica - LatifahI . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 29

Pengesanan mutasi pada gen beta globin melalui teknik nonradioaktif - Norizan K . . 3 1

Distribution of Lamborella stegomyiae in container breeding mosquitoes in Malaysia - Indra V . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 34

Microwave radiation and life - Mohd Khadri S . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 35

The epidemiology of leukaemias - Chin YM . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 37

Streptococcal infection as seen in Bacteriology Division, IMR - Rohani MY . . . . . . 40

GAMBAR KULIT

Sebahagian daripada aktiviti IMR

1. Penyelidikan

2. Pendiagnosan

3. Pembelajaran

Laboratory infections

I LABORATORY SAFETY AND CONTROL 1 I OF LABORATORY INFECTIONS 1

( Norazah Ahmad

Laboratory infections have continued to occur in spite of increased awareness of the hazards and the increased emphasis on safety devices and measures. It is therefore important that all laboratory personnel be familiar with the safety guidelines for the prevention of laboratory infections. Clinical laboratory personnel must be aware that neither the supervisor nor the safety officer alone can completely prevent laboratory- acquired infection. Safety and prevention of infections are the responsibility of everyone working in the laboratory.

A total of 3,921 rcportcd and rcvicwcd occupational infections revealed a fatality rate of 4% in occupationally acquired infections. From the recorded cases of laburatury -acquired infections accumulated since early part of this century, 159 different etiological agents have been incriminated to cause human infections. Out of these, 10 etiological agents were found to be responsible for over 50% of all laboratory- acquired infections. Twenty-six percent of these infections resulted in permanent disabilities while 4% in death.

Four basic elements are necessary for an infection to be initiated. These elements are the susceptible host, an infectious agent, the concentration of the agent and a suitable route of transmission. Laboratory workers can acquire infection via oral, respiratory, percutaneous and by direct contact with the skin and or mucosa.

There are many types of infectious agents, the most common being bacteria, fungi, viruses and parasites. Recombinant products, allergens,

cultured animal cells, tissue culture systems, human and animal specimens are all potentially hazardous. The transmission of these can be prevented if the laboratory personnel follow the guidelines on laboratory safety.

Laboratories can be systematically categorized into different levels of biological safety based on the risk associated with the hazards. Laboratories working with microorganisms usually are categorized as Biosafety Laboratory (BSL) 1,2, 3 and 4 according to the virulence of the organisms being handled. Micr~organisms handled in BSL 1 arc normally wcll-characterized and well-defined. They pose low or no potential hazards to the normal human beings and work un these microorgarlisms can be carried uul on the open laboratory bench. However, standard microbiological safety practices must still be followed when handling these microorganisms. BSL 2 are for handling microorganisms which pose potential hazards to laboratory personnel and are usually associated with human disease (e.g hepatitis B virus, Yibrio cholera). Micro- organisms in BSL 3 are highly infectious and may cause serious systemic disease in humans (e.g Mycobacterium tuberculosis). BSL 4 is a maximum containment laboratory and is for highly infectious and exotic microorganisms that can cause life-threatening disease. This category of laboratory is situated in isolated area or separate building and restricted to a small number of laboratory personnel.

When handling all human blood and certain human body1 fluids, laboratory workers need to strictly adhere to universal precautions which will

Laboratory infections

help to minimize the risk of exposure to bioodbome pathogens. Mouth pipetting is strictly prohibited. Eating, drinking, smoking and applying cosmetics are not allowed in the laboratory. Laboratory personnel should wear protective clothing and use disposable gloves when handling specimens and while doing procedures. Laboratory coats and gloves should not be worn outside the laboratories. Handwashing is the most important component of a microbiological safety program. Handwashing facilities, preferably foot or elbow operated, must be available in the laboratory area. An antiseptic liquid soap or foam should be used. Single use, disposable paper towels for hand drying should also be available. The working surfaces should be decontaminated using a recommended disinfectant at correct dilution at least once a day after completing the day's work and also after any spill of specimen or infectious materials. Biohazardous waste should he autoclaved and disposed off accordingly.

Specific training in processing and handling of infectious specimens should be given to all laboratory personnel. Each laboratory dealing with infectious agents should appoint its own

safety officer who should ensure that the laboratory personnel comply with the safety regulations and also conduct awareness programs to maintain the level of safety consciousness in the laboratory. Continuing medical education regarding laboratory safety regulations and handling of infectious agents should be carried out at regular intervals.

References

1. Laboratory Biosafety Manual. Second Edition. World Health Organisation. 1993.

2. Pike RN . Laboratory-associatedinfections : Summary and analysis of 3,921 cases. Health Lab. Sci 1976; 13: 105- 114.

3. Miller BM. Groschel DHM. Richardson JH, Vesley D, Songer JR, Housewright RD et a1 (1986). Laboratory Safety : Principles and Practices. American Society For Microbiology, Washington, D.C.

4. Isenberg HD, Chief Editor (1992). Clinical Microbiology Procedures Handbook. Vol 2. American Society for Microbiology, Washington D.C.

Polymerase

THE USE OF POLYMERASE CHAIN REACTION (PCR) ) IN MALARIA RESEARCH

\ Patricia Lim KC 3

Since the development of the polymerase chain reaction (PCR) by Mullis and colleagues at the Cetus Corporation (lo), this technique has been a major development in the analysis of DNA and R N A because i t has simplified existing technology and facilitated the development of new techniques in the field of molecular biology. In medicine, PCR has had a major impact on the diagnosis and screening of genetic diseases and cancer, the rapid detection of microorganisms such as viruses and some parasites and in HLA typing. In the molecular biology laboratories, PCR has been extensively used in processes such as probe preparation, clonc scrccning, mapping and subcloning and the preparation of sequencing templates.

In the field of malaria, various applications of the PCR have been made in the study of the pai-asite as well as the veclor. An important area in malaria research is the development of more rapid and sensitive diagnostic assays and a number of recent studies have indicated that PCR with species-specific primers gave fairly good specificity and sensitivity when compared to the conventional method of microscopic examination of blood films (1). The high sensitivity of the PCR was also demonstrated in a study in Guinea Bissau in which the PCR assay revealed a high incidence of P malariae and l? ovale that was greatly underestimated by microscopical examination (13). At the IMR, various PCR assays such as the Nested PCR, Enzyme detection-PCR and Plate hybridization-PCR are being evaluated for their usefulness in malaria diagnosis. ow ever, the feasibility of using the PCR assay as a field test requires consideration

of a number of factors such as cost and technicalitieq of <ample collection and procewing prior to performing the PCR.

An important aspect of the malaria parasite that requires great consideration in malaria vaccine development is the existence of antigenic variants which may hamper the development of a "universal" vaccine that is applicable to all parasite strains. Towards this end, efforts are being made to characterize malaria parasites from various geographical localities. The PCR has been found to be a very useful tool for the identification of polymoi-phism in natural populations of malaria parasites. Extensive polymorphism has been reported for several P Julcipurum ariligens such as the merozoile surface antigen 2 (2,8) and the ring-infected erythrocytic surface (RESA) antigen (4). Similarly, other workers have reported polymorphism of the merozoite surface protein 1 antigen (7) and circumsporozoite protein (1 2) of F vivax.

Spontaneous chromosome breakages are frequently observed in Z? falciparum and are responsible for the generation of novel phenotypes which may contribute to the pathogenicity and virulence of this protozoan parasite. The PCR has proved useful in studies to identifjr hot spots of chromosome breakages (5) and chromosome instability in P falczparum (9).

Sequence analysis of various malaria parasite genes have been carried out through the use of the PCR followed by sequencing of the PCR products. Examples of such studies include that

Polymerase

of the P vivax cysteine proteinase gene ( I 1) and the cytochrome C oxidase I11 gene (6).

In the study of malaria vectors, several researchers have used the PCR to differentiate cryptic n~osqui to species which were morphologically indistinguishable. Fritz et al. (3) detected variant populations of Anopheles ntmeztovar.i which had very minor differences in the DNA sequence of the ribosomal DNA ITS2 region using PCR. Similarly, Wilkerson et al. (1 4) demonstrated the usefulness of random amplified polymorphic markers as an effective means of differentiating two laboratory populations of morphologically indistinguishable African malaria vectors, An. gumbiae and An. urubiensis.

References

1. Barker RH Jr., Banchongaksorn T, Courval JM, Suwongkerd W, Rimwungtragoon K & Wirth DW. Plasmodium falclparum and P v i v a : factors affecting sensitivity and specificity of PCR-based diagnosis of malaria. Exp Parasitol 1994; 79: 41-9.

2 Felger 1, Tavul L, Kabintik S, Marshall V, Genton B, Alpers M, & Beck HP. Plasmodnim falclparum extensive polymorphism in meromite surface antigen 2 alleles in an area with endemic malaria in Papua New Guinea. Exp Parasitol 1994: 79: 106-16.

3. Fritz GN, Conn J , C'ockburn A & Seawright J . Sequence analysis of the ribosomal DNA internal transcribed spacer 2 from populations of Anopheles nenrztovarz (Diptera: Culicidae). Mol Biol Evnl 1994; 1 1. 406-16.

4. Kun JF, Leet M, Anthony RL, Kun JE & Anders RF. Plasmodium falciparunz: a region of polymorphism m the 3' end of the gene for the ring-infected erythrocyte surface antigen. Exp Parasitol 1994; 78: 41 8-2 I.

5. Lanzer M, Wertheimer SP, de Bruin D & Ravetch JV. Chromatinstructure determines the sites of chromosome breakages in Plasmodium falciparum. Nucleic Acids Res 1994; 22: 3099-103.

6 . Lim PKC, Kita, I(, Tan SK, Furuta T, Aoki T, Watanabe Y & Mak JW. Mitochondria1 cytochrome C oxidase I11 (COIII) gene of Plasmodium v i v a . Jap J Parasitol(1995) : in press.

7. Mancilla LI, Levitus G, Kirchgatter K, Kertens F, Herrera S & del Portillo HA. Plasmodium vivax: dimorphic DNA sequences Iiorr~ the MSP-I gerie code Tor regions that are immunogenic in natural infections. Exp Parasitol 1994; 79: 148-58.

8. Marshall VM, Anthony RL, Bangs MJ, Purnomo, Anders RF and Coppel RL. Allelic variants of the Plasmodium falciparum merozoite surface antigen 2 (MSA-2) in a geographically restricted area of Irian Jaya. Mol Biochem Parasitol 1994; 63: 13-21.

9. Mattei D & Scherf A. Subtelomeric chromosome instability in Plasmodium falciparum: short telomer-like sequence motifs found frequently at healed chromosome breakpoints. Mutat Res 1994: 324: 1 15-20.

10. Mullis K & Faloona F. In Methods in Enzymology Vol. 155 (ed. R. Wu), Academic Press, New York and London 1987 : 335.

11. Rosenthal PJ, Ring CS, Chen X & Cohen FE. Characteriztion of a Plasmodium v i v a cysteine proteinase gene identifies uniqucly conscrvcd amino acids that may mediate the substrate specificity of malarial hemoglobinases. J. Mol Biol 1994; 241 : 3 12-6.

12. Sattabongkot J, Suwanabun N, Rongnoparut P, Wirtz RA, Kain KC and Rosenburg R. Comparative tests of DNA probes for detection of Plasmodium vivax circumsporozoite protein polymorphs VK 247 and VK 2 10. J Infect Dis 1994; 169: 464-6.

13. Snounou G, Pinheiro L, Gonclaves A, Fonseca L, Dias F, Brown KN, & do Rosario VE. The importance of sensitive detection of malaria parasites in human and insect hosts in epidemiological studies, as shown by the analysis of field samples from Guinea Bissau. Trans Roy Soc Trop Med Hyg 1993; 87: 649-53.

14. Wilkerson RC, Parsons TJ, Albright DG, Klein TA & Braun KJ. Random amplified polymorphic DNA (RAPD) markers readily distinguish cryptic mosquito species (Diptera: Culicidae: Anopheles). Insect Mol Biol 1993; 1 : 205-1 1.

-- - --

IMMUNOLOGICAL APPROACHES TO THE DIAGNOSIS OF PARASITIC DISEASES: FILIARIASIS

/- .JW Mak

Introduction

The laboratory diagnosis of parasitic diseases may be relatively easy or difficult depending on the location of the parasite in the host. In general? the demonstration of the parasite should be attempted, although this may not always be practical. Parasitologists have developed various procedures to increase the sensitivity of parasite detection, including concentration techniques and in vitro culture to amplify parasite density. More recently, demonstration of specific DNA sequences, especially after polymerase chain rcslction (PCR) amplification has bccn applicd to many parasitic diseases, thus increasing the sensitivity and specificity of diagnosis. However, such procedures are relatively expensi vt: illid technically demanding. Immunological diagnostic techniques for parasitic infections have an important role to play in both patient care and epidemiological studies even though such assays only demonstrate infection indirectly. Certain assays, l ike the enzyme-linked immunosorbent assay (ELISA) have unique advantages, including batch processing of specimens. The present discussion will focus on the immunological diagnosis of filariasis for both patient care and seroepidemiology.

Laboratory Diagnosis of Filariasis

The demonstration of microfilaria in the blood or other body fluids, including urine and hydrocoel fluid, either directly using a Giemsa stained smear or after Nucleopore membrane filtration concentration, should be used to

diagnose infection in a patient suspected of having filariasis. However immunological evidence of infection may be the only means available in some clinical states of filariasis, including tropical pulmonary eosinophilia and other occult filarial conditions.

An immunological assay currently used in the Institute for Medical Research is the indirect f-luorcsccnt antibody assay (IFA) with Brugicc ~nulcryi and Brugia puhangi microfilarial and adult worm antigens. To increase the chances of dctectirig filarial antibodies, multiple antigens are used in the assay as various antibody types are present in the different clinical states. Titres of 1 : 40 and above and 1 : 8 and above with microfilarial and adult worm antigens respectively, are 'considered positive. However, as this is a screening test, a positive result only indicates that the patient has antibodies against filarial antigenic epitopes. It does not discriminate between current or past infections; neither does it specify whether the infecti'on is brugian, bancroftian or dirofilarial. Other nematode infections may also give a low titrle with the assay, as the immunodominant epitope is a phosphorylcholine shared by many nematodes. The interpretation of the assay results should therefore be guided by the medical history of the patient, laboratory evidence of other nematode infections, and other confirmatory laboratory tests. Demonstration of specific subclass antibodies may be useful as specific IgGl antibodies are significantly higher in

Filiariasis

elepllantiasis corrlyared tu rnicrolilaraemic. patients, whereas IgG4 levels are 17 times higher in micro-filaraemics (Hussain et al., 1987). Corllirrrlatvry tests include demonstration of specific immunoglobulin subclass antifilarial antibodies and immunoblot analysis of positive sera.

Polyclonals or monoclonal antibodies (mabs) that detect soluble antigens are potentially useful as diagnostic reagents to detect infection. The sensitivity of such soluble antigen detection assays are not limlted by the periodicity of microfilaria. Various non-structural, water- soluble major proteins are shed by fourth stage larva (L4) and adult worms, of which a highly conserved 30 kDa antigen contains cross-reacting epitopes in all lymphatic parasites (Devaney et al, 1990). In addition, other surface proteins shed from the cuticle of infective larva (L3), L4 and adult worms include a 15 kDa epicuticle protein, while another important group of antigens are those that contain phosphorylcholine epitopes. These which are located within the reproductive organs and eggs of female and the guts of male B. malayi, contain antigens of MW 25-30 kDa, 57-90 kDa and about 200 kDa. These, if produced in sufficient quantities can be targets of antigen detection assays using specific mabs. Various mabs have been developed and used in immunodiagnostic assays. Most of these are not species specific and can detect circulating antigens in Rrugia and FGrchereria infected hosts. A mab produced against in vitro products of B. pahangi, detected circulating antigens in B. pnhnngi, B. malayi and Dirofilaria immitis infected hosts (Wan Omar et al, 1993). Zheng et a1 (1987) detected circulating antigens in bancroftian and brugian filariasis sera with n sandwich ELISA using a polyclonal antibody and mabs; 94%, 34% and 14% of microfilaremic, symptomatic filariasis, and cndcmic control bancroftian filariasis being positive respectively. Similarly 89% and 68% of microfilaremic and sympton~atic brugian filariasis were positve

respectively. Serum levels or antigens detecled with the assay correlated well with microfilarial density. However many mabs produced are directed against phosphorylcholine (PC) epitope containing antigens which are common among filarial and other nematode parasites, a good example being Gib 13, a mab produced against Onchocerca gibsoni . This has been used to quantitate serum levels of PC epitopes as a correlate of adult female worm levels in experimental B. malayi infections (Wenger et al., 1988). Using Gib 13 Dissanayake et a1 (1984) detected as antigen positive, all microfilaremic subjects with W bancrofti from Sri Lanka and Papua New Guinea. Of those amicrofilaremic patients, 47% with lymphoedema, lymhangitis and hydrocoele, and 25% with elephantiasis, were positive.

The above studies show that ELISA.based assays using specific mabs can detect circulating antigens in all microfilaremic individuals. This means that with further refinements, such assays can theoretically be used in filariasis surveys to measure endemicity as well as to monitor the effectiveness of control programs.

It is useful to use immunoblot analysis of sera to confirm filarial infection. Soluble B. malayi adult worm antigens are used in the analysis. Sera from elephantiasis patients showed a highly complex pattern, recognizing a wide range of polypeptides of 22,28,35 and 94-105 kDa (Mak et al., 1989). Tropical pulmonary eosinophilia (TPE) patients rccognizcd polypcptidcs at 13,17,47-56,66 and 74 kDa. Microfilaraemic subjects recognized prominently those at 16, 29, 47-60 and 77 kDa in microfila~ial antigens arid thost: uf 66, 74 arid 84 kDa in adult worms. Elephantiasis patients recognized a unique band at 30 kDa of adult worm antigens not seen in other clinical groups.

Filiariasis

Studies were also carried out to determine the pattern of specific antigenic polypeptides recognized by sera of microfilaremic patients and monkeys and to see whether there were changes in such patterns after chemotherapy with microfilaricidal and adulticidal drugs (Mak et al., 1994).

Patients with subperiodic B. malayi infection were treated with single doses of oral ivermectin at 20 - 200 glkg. This compound was shown to be an effective microfilaricide at these dosages (Mak et al, 1993). Sera were collected at weekly intervals for the first month and then at 6 monthly intervals. In another study, Presbytis cristata experimentally infected with B. malayi, were treated with oral CGI 18041, a benzothiazole, at 50 mglkg x 1 day. At this dose microfilaricidal and adulticidal activities were complete as shown by the disappearance ofmicrofilaremia at the first post-treatment week and the absence of live worms at autopsy 6 weeks post-treatment (Mak et nl, 1995). Serum were collected from these animals at pre-treatment and at weekly intervals post-treatment.

In general, microfilaremic sera recognized distinctive antigenic polypeptides of B. malayi between 15 to 140 kDa. Prominent bands recognized were at 15, 18,29,33,39,42,45,66, 76,82,94, 11 0, 125 and 150 kDa. Most reactive epitopes wei-e recognized by sera cvllecled at pre- treatment, 1,6 and even 22 months post-treatment with ivermectin. As ivermectin is known to be a microfilaricide and not an adulticide, it is possible that these reactive epitopes are present in microfilaria as well as adult parasites or their products.

Antigenic epitopes recognized by experimentally infected monkeys were less intense and fewer in number than those seen with patients' sera. Polypeptides recognized prominently by sera of

microfilaraemic monkeys were at 28-3 1 kDa, 58- 72 kDa and 1 16- 140 kDa. Antigenic epitopes recognized by sera at gre- and 6 wks post- treatment were essientially similar, probably due to persistence of antibodies during this period, even though only dead parasites were recovered at autopsy (Mak et al., 1995).

Experimentally infected monkeys' sera showed fewer and less intense polypeptide recognition patterns than those of microfilaraemic patients, probably reflecting the shorter duration and intensity of infection in monkeys which were put on the drug trial within a few weeks of patency.

Conclusion

Recent advances in antigenic characterization of filarial parasites and the development and use of mabs for the detection of circulating antigens have provided more convenient techniques than the detection of microfilaria in giemsa-stained blood films, for mass screening for filarial infection. Further refinements of such assays may allow thc rcplaccmcnt of thc lattcr in filariasis surveys. Distinct antigenic patterns are seen on immunoblot analysis of sera from filariasis patients. These antibody I-ecognition patterns of SDS-PAGE separated filaria antigens did not change substantially in microfilaraemic patients treated with oral ivermectin, a known microfilaricidal drug, probably due to shared epitopes between microfilariae and adult worms. Similar antigenic recognition patterns were also seen in pre-treatment and 6 weeks post-treatment sera of microfilaremic monkeys treated with CGI 18041,. a known adulticidal drug, probably resulting from continued stimulation of antibodies by dead and degenerating parasites. It is recommended that future studies on such changes should be carried out in sera taken at monthly intervals over a period of at least 6

Filiariasis

months post-treatment to monitor the effect of adulticidal compounds. In general the immunoblot pattern of reactive polypeptides in adult worm antigens recognized by sera from various clinical filariasis groups are distinctive and can be used to confirm filarial infection when the parasite is not demonstrated.

References

Devaney E. Betschart B, Rudin W. The analysis of the 30 kDa antigen of Brugiapahangi and its interaction with the cuticle: a short review. Acta Tropica 1990; 47: 365-72.

Dissanayake S, Forsyth KP, Ismail MM, Mitchell GF. Detection of circulating antigen in bancroftian filariasis by using a monclonal antibody. Am J Trop Med Hyg 1984; 33: 1130-40.

Hussain R, Grog1 M, Ottesen EA. IgG antibody subclasses in human filariasis. Differential subclass recognition of parasite antigens correlates with different clinical manifestations of infection. J Imrnunol 1987; 139: 2794- 8.

Mak JW, Choong MF and Ngah Z. Immunoblot analysis to evaluate the efficacy of chemotherapy in parasitic diseases. Proc. Sixth Nat Biotech Sem, 17-1 8 November 1994, Penang, pp 130- 13 1.

Mak JW, Choong MF and Tan MAJA. Im~~~urlulogical basis of pathogenesis in lymphatic filariasis. In: Immunological & Molecular Basis of Pathogenesis in Parasitic Diseases, Ed. KO RC. Univ Hong Kong, Hong Kong, 1989; pp 47-56.

Mak JW, Navaratnam V, Grewel JS, Mansor S and Ambu S. Treatlr~erlt uf subpel-iodic Br@u rnalqi infection with a single dose of ivermectin. Am J Trop Med Hyg 1993; 48: 591-6.

Mak JW, Ngah Z, Choong MF and Navaratnam V . Chemotherapuetic effect of CGI 1804 1 against subperiodic Brugia malayi infection in Presbytis cristata. Trop Med Parsitol 1995; 46: 6-8.

Wan Omar A, Oothuman A, Yunus H. Detection of circulating antigens and parasite specific antibodies in filariasis. Southeast Asian J Trop Med Pub Hlth 1993; 24 (Suppl2): 3 1-6.

Wcngcr JD, Forsyth KP and Kazura JW. Identification of phosphorylcholine epitope-containing antigens in Bvztgia malayi and relation of serum epitope levels to infection status ofjirds with brugian filariasis. Am J Trop Med Hyg 1988; 38: 133-41.

Zheng H, Tao Z, Reddy MVR, Harinath BC, Piessens WF. Parasite antigens in sera and urine of patients with bancroftian and brugian filariasis detected by sandwich ELISA with monclonal antibodies. Am J Trop Med Hyg 1987; 36: 554-60.

TRENDS IN HIV TESTING /

Introduction

Human Immunodeficiency Virus (HIV), the etiological agent of Acquired Immunodeficiency Syndrome (AIDS) is a retrovirus. A latent form (HIV provirus) is established when a DNA copy (or copies) of the viral genome is integrated into the host cell's genomic DNA. Clinically healthy individuals may harbour the latent HIV proviral genome and remain serologically negative for months.

Currently there are several laboratory diagnostic approaches to detect HIV infection namely, detection of (i) specific HIV antibodies (ii) HIV antigen (iii) virus isolation by culture and (iv) HIV genome detection by PCR.

The Enzyme linked Immunosorbent Assay (ELIS A) screening test for HIV antibodies offers a rapid, cost effective procedure for seroconverted individuals. The currently available ELSA antibody screening tests have reached the limits of high sensitivity and specificity but they are still prone to some amount of false reactions. Tn the past this called for re- testing using more specific supplementary antibody tests such as Western Blot (WB), Immunoflourescence Assay(IFA), Radio- immuno Precipitation Assay(R1PA) which are all technically demanding as well as expensive.

Viral culture permits direct detection of the infectious virus. Consequently, it may remain the reference method for detecting HIV infcction, although its sensitivity and specificity vary greatly among the different culture methods. The low sensitivity of the method coinbirled with the

need for costly containment facilities and staff expertise makes HIV culture unsuitable for use as a screening test.

The HIV antigen test detects the p24 core antigen of the HLV. It is useful in the diagnosis of the acute syndrome caused by HIV at which point, HIV-antibodies are often not present. Although this test is highly specific, it has a low sensitivity due to fluctuating serum levels of antigen during the course of the disease, or antigen may be complexed with antibody and therefore not detectable.

The Polymerase Chain Reaction (PCR) is a relatively new method applied for the detection of HIV. PCR, which allows the exponential amplification of a nucleic acid sequence in the HIV proviral DNA is particularly useful in patients with low numbers of infected lymphocytes. Since PCR reacts with DNA directly, it can detect the HIV provirus with great sensitivity. PCR for HIV detection has been shown to detect the presence of the virus before an individual's body has produced an antibody response (sero-conversion). This test also has the potential to detect HIV'DNA in patients where antibody tests may be ineffective, such as infants born to HIV sero-positive mothers. However this test like the viral culture and RIPA is limited to specialised centres because it not only requires specialised equipment and containment facilities, it is also labour intensive and technically exacting.

A variety of laboratory surrogate markers, biochemical markers and lymphoid markers can be measured such as lymphocyte subsets, 2

microglobulin and neopterin. These are not specific for HIV infection as their levels fluctuate in other unrelated infections or diseases as well. They are only useful as prognostic markers to predict advancing HIV infection or disease progression which is reflected by lymphopenia, a fall in CD4+ cells and increase in CD8+ cells Generally an increase in P2-microglobulin and neogterin levels are reflective of disease severity. Commercial interests have also provided a battery of virological tests to assess disease progression in HIV infected individuals such as the p24 antibody and antigen tests. Although the technology is available the laboratory costs often limit thelr use.

The individual markers measured at a single point in time may be weak indicators of disease progression. Thc usc of a combination of several prognostic markers measured serially over time can enhance the accuracy of the prediction of disease progressiwl a d disease severity.

It may be said that highly sensitive and specific screening tests using recombinant and synthetic peptide antigen, as well as tests for IgM and IgG antibodies detection have been introduced. The assays are user-friendly and can detect both HIV- 1 and HIV-2. Antibody confirmation tests have also reached the limit of present technology.

Western Blot (WB)

The HIV Western Blot test is specific for HIV antibodies directed to individual structural polypeptides of HIV and in the past was widely used as adjunct (suppplement) to ETA. Despite its high specificity, result are frequently labelled indeterminate due to a banding pattern demonstrating antibodies to several gene products, but not the pattern required for positive determination.

There is also controversy surrounding the interpretation of HIV-Western Blots. There are several different criteria for interpretation of WB reactivity such as the FDA criteria, CDC criteria, American Red-Cross criteria, Consortium for Retrovirus criteria, Serology Standardisation criteria and the manufacturer's criteria.

There is very little agreement between them on what constitutes a 'positive' result except that they all agree that no band means a negative result and indeterminate result means presence of any band or bands not meeting the criteria for a positive result.

In ow expcricncc at thc National AIDS Rcfcrcncc Laboratory (NARL), it is not unusual to obtain an 'indeterminate' WB result in a full blown AIDS case using a stl-ingent interpretation criteria. Due to these problems of. subjectivity and controversies surrounding its interpretation, the Western Blot has largely remained within specialised Reference Centres which not only have the required expertise but also the benefit of access to other research tools as well as to arrive at a conclusive diagnosis.

An alternative to Western Blot confirmation is the use of a series of HIV Antibody (AB) screening assays (rather than relying on just one test) utilising different formats eg: Indirect EIA, competitive EIA, AB capture EIA, sandwich EIA, particle agglutination (PA) and in addition utilising antigens from different sources. This is the new strategy recommended by WHO in 1992 and which has been widely accepted world-wide. The validity of positive results obtained in these 2 or 3 tests in series equals or approximates the validity of Western Blot results.

In 199211 993 WHO recommended three testing strategies. The choice of the most appropriate strategies depends upon the:-

(i) objective of testing;

HIV

(ii) the prevalence of HIV in the population being tested; and

(iii) sensitivity and specificity of test kits.

Table 1: WHO'S Anti-HIV Testing Strategies:

Objective of Prevalence Testing testing of infection strategy

- - --

Transfusion/donation all I

Surveillance > 10% I

< 10% I1

Clinical signs1 symptoms of Hl V all 11

asymptomatic < 10% 111

WHO Strategy I

All sera are tested on one screening test only. This strategy is for safety of blood transfusion and organ donation. Blood/sera giving reactive result are considered HIV-antibody positive and are discarded. In populations with low HIV antibody prevalence a highly sensitive screening test is bound to produce false reactive results; therefore the NARL recommends that results from this strategy be not notified to the blood donor. The individual should be recalled, his risks for HIV assessed then be re-tested according to strategy I1 or 111 (whichever is relevant to his case) before a diagnosis is given on his true HIV status.

WHO Strategy I1

Serum is tested first on an ELISA or rapid test. Any reactive sera are subjected to a second test

selected based on different antigen preparation and test format.

(-1 Serum that is non-reactive by the first test is considered HIV-Antibody negative.

(+I+) Serum reactive by both tests is considered HIV-AB positive.

( I - ) Provided that the selection of the tests is based on high sensitivity followed by a high specificity assay, any serum Lhat is reactive by the first test but non-reactive by the second test is also considered antibody negative.

According to WHO recommendation, strategy I1 is for surveillance in populations with HIV AB prevalence of less than 10%. Strategy I1 is also applicable in clinical situations for making a diagnosis in a patient with clinical symptoms and signs of HIV infection1AIDS. It is also applicable for asymptomatic individuals who are in the "risk for HIV" category.

WHO Strategy 111

Blood sampleslsera are first tested on one ELISA or rapid test. Any reactive samples are re-tested using a second test. Reactive samples on second test are subjected to a third and different test.

Strategy 111 is recommended for diagnosis of asymptomatic, low risk individuals in populations with low HIV prevalence.

Howcvcr, thc WHO rccommcndations 'do not state which commercial tests should be combined together for those strategies (strategy I1 & 111) requiring a battery of 2 arid 3 tesls. Which assays to select has been left to individual laboratories to decide for themselves. Therefore the NARL has chosen to use the ELISA (Abbott, 3rd

HIV

Generation) arid the Scrudia Particle Agglutination Assay (Fujirebio) based on our past experience with these or similar tests over the past 10 years.

The decision on which commercial test to use in the 2 test and 3 test strategy will, in addition, be influenced by various other factors such as the:

- availability of laboratory infrastructure; - access to a reference laboratory; - technical skill of available personnel; - characteristics of the test, ease of

performance and time; - price, availability and support system

available; and - reagent stability and storage condition.

Post-decentralisation Experience

Since the 2-test strategy was decentralised in 1994, our observation is that fewer blood and sera require processing beyond the ?-test strategy. There has been considerable savings of finance, time and labour. Blood donors who test positive in the 2-tests strategy should have their risk for HIV re-assessed. The Immunoblot is often requested as a third supplementary test for blood donors who are believed to be at 'low risk' for HIV or whose risk is 'unknown'. Not having assessed the donorc HTV risk adequately should not be a justification for demanding expensive laborious additional third line supplementary testing The NARL experience on these so called 'low risk groups' including blood donors in this country confirms that those individuals who tested repeatedly positive on the 2 test strategy (EIA & PA) are truly HIV infected; an additional third test on these mistakenly labelled 'low risk' individuals is often unnecessary to prove their infected status!

Sirr~yle Rapid Tests

The definition of a simple rapid test is one which is not automated and requires lillle or 110

instrumentation. The results are read visually and ready within one hour.

A number of rapid simple tests are now commercially available. Most of these require little or no instrumentation; results are ready in a shorter time than ELISA and results are read visually. These tests are suitable for use in laboratories with limited resources for low numbers of specimens and on high risk populations with high HIV prevalence.

There is no need for 'batching' as samples can be tested individually on a simple rapid test, although this will be more expensive since the negative and positive controls must be included with each test sample.

A disadvantage of the simple rapid test is that since results are visually read, therefore they may be subjective; no permanent record of results are available for future reference in the event of any dispute occurring at a later date. Furthermore, many of these simple rapid tests are several times more expensive than the automated ELISA or the PA. More important, their sensitivities may not match those of the ELISAs.

.Simple rapid tests are not recommended for use in a blood transfusion centre to influence decision on transfusion of blood or blood products since results are subjective and no permanent record of results are available for subsequent rechecking.

A policy decision on the introduction of simplc rapid tests will have to take into consideration the following factors: laboratory infrastructure, technical skill of available pel-somel, pi-ice and availability of simple test kits, performance of

HIV

test and any previous experience of that test on the local population. The last criteria may be the limiting factor in their introduction here since we have no large scale experience with the new simple rapid assays.

The NARL proposed the following guidelines for use of simple rapid tests for HIV-Ab.

No one test gives infallible results! Simple rapid tests must always be backed up by a more sensitive screening test such as the ELISA. 'l'herefore a blood sample must be sent for EIAIPA test according to routine protocol each time.

There is a need for pre-test counselling which must be carried out according to established protocols before carrying a simple rapid test. Post-test counselling and notification of HIV results to the patient is carried out only when the results of the backup test arrives. (i.e. strategy I1 test results).

Many manufacturers play up the speed of obtaining results from the simple rapid test as being a big advantage. However, given the serious implications of a positive result, is there sufficient t ime for pretest counselling in the few minutes it takes for the results to be ready?

Simple rapid tests are not recommended for home-use or by untrained personnel.

Persons (MLTs or doctors) using this test should be trained in the technique and be made awarc of proper quality control, storage conditions and interpretations.

Only those test kits approved by WHO arid by the United States of America-FDA ought to be considered for entry and sale in

Malaysia to prevent dumping of sub- standard commercial kits. In addition, the licensing of laboratories should be considered to ensure uniform quality and standard of HIV testing throughout the country.

The Use Of Diagnosis

Non-invasive Samples For HIV

The most widely used sample for HIV diagnosis is still blood (serum). Recently oral fluid has been suggested as an alternative test sample, and several test kits for saliva anti-HIV testing have been described in a number of experimental studies.

However there are several issues thgt need to be addressed before a recommendation on the routine use of oral fluid samples for HIV antibody detection can be made. (WHO, 1994).

There are some unresolved issues concerning use of oral fluids for HIV testing namely:

i) Which is the most appropriate oral fluid to use? saliva, crevicular fluid or mixtures?

ii) Which tests produce the most acceptable results?

iii) Can oral fluids be used for different testing situations eg. surveillance, diagnosis?

iv) What is the best confirmatory strategy to use to verify infection using these fluids? Currently, centres in developed countries experimenting with oral fluid testing, confirm diagnosis by serum tested un routine Western ,blot, or by saliva on special saliva Western blots.

HIV

v) What effect do oral diseases have in the collection of oral fluid quantity and quality and presence of sufficient immuno- globulins?

vi) At present these are no standards or oral fluid quality assessment panels available for evaluating testingproficiency.

vii) Since HIV-Ab testing in a risk population is only one item in a battery of other tests for infectious diseases, a way must be found to circumvent the need to collect several different types of samples from the same individual eg. in IVDUs, saliva for anti-HIV test; blood for VDRL and HBs Ag and urine for drug detection.

In 1995, the US FDA approved a collection device for saliva collection (Orasure), to be tested for anti-HIV antibodies on a specific ELISA test kit viz. Organon Uniform 11. Its applicability in the local setting needs to be evaluated.

In saliva ofHlV infected individuals, high levels of IgG detected in saliva has been reported to be similar to that of serum. This vinis specific TgG in saliva is almost entirely derived from plasma by transudation through the blood capillaries around the gingival crevices.

When the initial ELISA on the saliva is reactive, confirmation of diagnosis currently requires that the individual's blood be next tested on the Western blot. The US FDA approval is being awaited for the saliva Western blot, which will negate the need to perform parenteral collection of blood after initial collection of saliva.

Urine has also been suggested as another alternative test sample for HIV-antibody detection. In urine, the anti-HIV concentrations of IgG are 10,000 to 20,000 folds less than serum levels and derived probably from leakage of blood vessels in the urinary tract but using very sensitive screening tests, these urinary HIV antibodies are detectable.

Kecent developments to advance the use of non- invasive specimens for HIV testing involve the refinement of collection devices and collection procedures. The large commercial interest shown in this approach will perhaps also in the future lead to the availability of commercial tests which will replace blood specimen by non-invasive specimen such as urine and saliva and designed as single use kits for outside the diagnostic laboratory, for use in the physician's office, or perhaps even in the patient's home,.in a manner similar to the home pregnancy test.

References

1. Parry JV . A specimen of Convenience: Medical Laboratory World 199 1 : 13- 15.

2. Parry JV, Perry KR, Mortimer PP. Sensitive assays for viral antibodies in saliva: an alternative to tests on serum. Lancet 1987; ii:72-75.

3. Tamashiro H,Constantine WT. Serological diagnosis of HIV infection using oral fluid samples. Bulletin WHO 1994: 72 : 135-43.

4. Current WHO'S Recommendation on Anti-HIV Testing GPAlRESlDIAl93-6.

Dengue

PRACTICAL ASPECTS OF LABORATORY DIAGNOSIS OF DENGUE 1

Dengue infection, ranging from asymptomatic infection to dengue haemorrhagic feverldengue shock syndrome continues to be a public health problem in many parts of the world including Malaysia.

Early laboratory confirmation of dengue infection is essential for proper control measures to be undertaken cost effectively. As is true for majority of viral infections laboratory diagnosis of dengue can be done by the following methods:

I ) isoIating the virus from a patient's body fluids (blood, serum, CSF) and biopsy material

2) serological diagnosis from patient's body fluids (serum and CSF) i.e. detecting rising IgG, or detecting IgM

3 ) detection of viral genomc from body fluids and biopsy specimens.

Virus Isolation

The techniques available fur isulation o r the Dengue viruses are:

1 ) animal inoculation (suckling mice) 2) mosquito inoculation (adult female

mosquito) 3) larval inoculation (Toxorhynchitis larvae) 4) tissue culture.

The most convenient sample for isolation of dengue virus is blood which has to be collected within the first 5 days of illness and transported in ice to the laboratory as soon as possible. The

most common method presently used is the tissue culture method provided there is an adequate tissue culture maintenance facility and personnel with the required expertise. This is the method in use in the IMR. Results can be obtained in approximately I0 days. Generally virus isolation methods are labour intensive, time consuming. expensive and are practical only in a reference laboratory. The advantages of viral isolation are that it provides:

1) definitive and conclusive evidence of infection

2) typing of the isolates can be done for surveillance and control measures

3 ) sequencing of these isolates can be done for molecular epidemiological research.

Serological Diagnosis

Presently serological diagnosis is by far the most practical method for the diagnosis of denguc infection. Before the advent of the modern techniques like the ELISA techniques, the .traditional methods like the haernagglutiriatiori inhibition (HI), complement fixation technique (CFT), plaque reduction neutralisation technique (PRNT) were the methods used. The HI and PRNT methods are highly sensitive and specific but they have the disadvantages of being labour intensive, time consuming as well as requiring paired sera (acute and convalescent taken at least 5 days apart), animal houseltissue culture facilities. 'l'he test takes approximately 3 days. However, since paired sera are needed, results will be available generally after the patient has recovered.

Dengue

The development of ELISA tcchniques foi- dengue diagnosis in the 1970's gave a spurt of hope that a relatively rapid, simple and sensitive tcchnique was on the way for use in clinical virology laboratories. However it was only with the development of the dengue IgM ELISA that a reasonably standardised ard practical tesl was adapted for use. Currently the IMR uses an in- house modified dengue IgM ELISA (1). Results aIe obtained within 5 hours as compared with 3- 5 days for the traditional tests. This test is ideal for centres handling at least 100 samples per week. Key reagents are not available commercially. Thus the IMR, University Malaya (UM) and University Sains Malaysia (USM) are working towards modifying methods to produce these reagents in a large scale (2,3). However, this test is presently confined to reference laboratories only.

The dengue IgG and dengue IgM blot test is now available commercially. These tests use the ELISA principle but the capture reagent (dengue antigen for the dengue IgG blot and anti-human IgM for the dengue IgM blot) are dotted on a membrane instead of being coated on a microtitre plate. The result of this test can be read visually and does not need an ELISA reader. For the IgG blot test results can be obtained in approximately 4 hours and IgM blot test in 24 hours. These tests have the advantage of being simple to perform and do not need any special equipment. They are suitable and cost effective for use in laboratories that handle up to 40 samples per week. The sensitivity and specificity of these tests as evaluated by the TMR i s liqted in Figure 1 . Results by the IMR and other reference centres (4,5) have shown that these tests are suitable as first line tests in peripheral laboratories. After an extended evaluation done by the IMR the dengue IgG blot was adopted by the MOH for use in the peripheral laboratories as a first line test. The recornmendcd algorithm in use by the MOH laboratories is as shown in Figure 2.

Genome Detection

Genome detection using PCR has recently been introduced tu marly reference laburaturies. We have found it to be useful as a complement to our present serological test especially in sample collected within 5 days from onset of symptoms (6,7,8). PCR will be especially useful in establishing dengue infection from autopsy samples (if available) if antemortern samples are not available to confirm dengue infection. In situ PCR can be performed for relevant samples.

All in all, at this present time the modern serological methods like dengue IgM ELISA and the dot blot methods will be the main stay of clinical virology laboratories. Reference test like HI, virus isolation and PCR will be available in reference laboratories in Malaysia (University Malaya, University Sains Malaysia and the IMK).

References

1. Lam S K, Devi S, Pang T. Detection of specific IgM in dengue infection, Southeast Asian J. Trop. Med. Pub. Hlth. 1987; 18(4);532-7.

2. Halimah M, Vijayamalar B, MJ Cardosa, M Sinniah, A Igarashi, H Tanaka. Comparative Assay on Dengue IgM- ELISA using Reagents from 2 sources, Tropical Medicine, Japan, in press.

3. Halimah M, L del Carmen Castillo, M Sinniah, A Igarashi. Elevated Incubation Temperature Enhanced Antigen Production of Dengue Type 2 and 3 viruses in the infected Aedes albopictus clone C6136 cultures. Tropical Medicine, Japan, 1995; 37(1); 2 1-27.

4. Cardosa M J. Diagnosis and Surveillance of Dengue virus infections: gold standards and new directions. Mal. J. Pathol. 1989; 11: 7-10.

5. Chan Y C, Lai 0 F, Ngoh D L, Tan H C, Chan L. Dengue diagnosis using a commercial kit (Dengue Blot): a prvspective sludy. Proceedings of the VIII International Congress of Virdogy, Berlin, August 26-3 1, 1990.

Dengue

6 . Balasubramaniam V. Thayan R, Zainah S, Chew T K, Morita K, Sinniah M, Igarashi A. The use of rapid reverse transcriptase-polymerase chain reaction on clinical samples. Proceedings of the 6th National Biotechnology Seminar, 17-18 Nov 1994, pp 145-8.

7. Ravindran T, Vijayamalar B, Zainah S, Chew T K, Sinriiah M, Igarashi A. The use of Polymerase Chain Reaction for diagnosis of Dengue in the Institute for Medical Research. Southeast Asian J . Trop. Med. & Pub. tllth., in press.

Figure I. Sensitivity and specificity of dengue blot test evaluated*

by the Virus Department, IMR

(a) Dengue IgG Blot

Sensltwity Primary infection 77.14% (71195) Secondary infection 95.OO0/o (57160)

Overall 86.07% (128i155)

Specificity 93.75% (90i96)

(b) Dengue 1gM Blot

Sensitivity 89.75% (3 1139)

Sepecificity 91 37% (53155)

8. Zainah S, Thayan R, Balasubramanialn V, Morita K, Tsuchie H, Sinniah M, Igarashi A, Tanaka H. Use of reverse t~anscriptase poly~ne~ase chain ~eactiun To1 diagriuais uf dengue virus infection compared to IgM-ELISA. Trop Med 1994; 36(3):75-8 1 .

J

*The sample population used were all verrified by the HI test.

Figure 2. Flow Chart for Dengue Serology for MOH Laboratories carrying out Dengue Blot (IgG)

Single Serum Ifclinically indicative of Sample Encephalitis

DENGUE BLOT I

Please send I st and 2nd sample (I@) to IMR

Positive Negative Inconclusive I I I

Report: Report; . Report;

Dengue Blot Test - Dengue Blot Test - negative. Please Inconclusive. Presumptive positive send a second sample taken at least Send sample to IMR

5 days after the first sample I

Second Sample

I Der~gue Blul (I@)

I _____1

POSITIVE NEGATIVE I

Report: I

Send 1 st and 2nd sample Dengue Blot Test - with clinical history to

Presumptive positive IMR for further tests.

SUMMARY OF 1994 ANTIBIOTIC RESISTANCE I SURVEILLANCE RESULTS 1

1. In 1994 antibiotic susceptibility pattern of (iv) Pseudomonas spp - 4.95% 42,976 bacterial isolates from 15 hospital (v) Klebsiella pneumoniae - 5.56% laboratories were analysed. (vi) Acinetohacter spp - 8.79%

2. The common bacteria encountered were a) Stuphylococcus uuretis - 20.84% b ) Escherichio coli - 17.54% C) Klehsiella pneztmoniae - 9.90% d) Pseudomonas aeruginosu - 4.65%

3. The common specimens that contributed to these bacterial isolates were:- a) Pus and wound swab - 38.0496 b) Urine - 19.61% C ) Blood - 10.35% d) Genital species - 8.20% e) Sputum - 7.70%

4. The culrlrrluri age gruup horn which Lliese isolatzs came from were:- a) 21 - 30 years - 13.19% b) Newborn - 12.69Y0 c) 3 1 - 40 years - 11.24% d) 51 - 60 years - 8.42%

5. The common organism encountered from the following specimens were:-

a) Pus and wound swab (total no. 16,350) (i) Staphylococcus aurezrs - 34.35% (ii) Escherichia coli - 11.00% (iii) Pseudomonas neruginosa- 10.79% (iv) Klebsielln pnecrrnoniae - 6.59%

b) Blood (total no. 4446) (i) Stuph~~lococc~~s epidemidis +

coagulase negative Staph. 29.47% (ii) Sta~~hylococcusuu~~ezrs - 14.98% (iii) Eschericlziu coli - 8.14%

c. Urine (total no. 8426) (i) Escherichiu coli - 45.26% (ii) k;T~h~i f / ln~~nez~rnot? iue - 11.32% (iii) Stnphylococczrs ailreus - 5.66% (iv) Klebsiella spp - 4.41% (v) Psez ihmon~s L I Y ~ Z ~ ~ Y I O S C I - 4.14% (vi) P~otezw mirabilis - 2.79%

d. Sputum (total no. 33 10) (i) Klehsiellcc pentinzoniae - 3 1.45% (ii) Pseudomonas crerz~ginosa- 10.09% (iii) Klebsiella spp - 8.9496 (iv) Huemophilzrs injluenx~e 1 5.74% (v) Brrnahamelkr cntarrhdis -'I 4.23%

\

e. Stool (total no. 568) (i) Salmonella spp - 63.50% (ii) Escherichia coli - 20.77% (iii) S. typhi - 2.64% (iv) Shigelk~flexeneri - 2.46%

f. Cerebrospinal fluid (total no. 96)

(i) Stuphylococcus epidemidis 1 5.63% (ii) Haemophilus inJIuensae - 12.50% (iii) Escherichia coli - 10.42% (iv) Acinetobacter spp - 7.29% (v) Streptococcus pneumonicie- 6.25%

6. Resistance Rates

Before examining the resistance rate of the organisms closely, it must be remembered that the margin of error in which only a small number was tested would be high as it would

Summary

require at least 150 strains to be tested before a confidence level of 95% is achieved if the expected resistance rate is 10%. Secondly, some hospitals only tested the second line drugs for isolates that were resistant to the first line drug eg. Amikacin, third generation cephalosporins and Imipenem, therefore the resistance rate to these may be lower than what was reported in this table.

Staphylococcus aureus In 1994, 26.77% of all S.aureus tested were MRSA. Of the MRSA strains, resistance to hsidic acid was 6.0% and Rifampicin 4.0%. Resistance to perfloxacin was 3 1.2%. The report of 0.2% resistance to Vancomycin, the antibiotic of choice for treating MRSA infections was not confirmed.

Escherichia coli Comparing the resistance rate to the previous years, there was no significant changes. Resistance to Ampicillin was 60.2%. Resistance to the Cephalosporins varied from 4.0 to 14.1%. Resistance to Gentamicin was 7.2% while the corrected resistance to Amikacin was 3.6%. Resistance to Cotrirnoxazole was 40.2%. Resistance to Nitrofurantoin was 5.6%, Nalidixic acid, 5.4% and both Norfloxacin and perfloxacin were 1.8% and 2.6%.

Pseudomonas aeruginosa Again no obvious differences in resistance rate compared to previous years. Resistance to Gentamicin was 19.1 % while amikacin was 5.7%. Resistance to the antipseudomonal penicillin, piperacillin was 13.1 %. The 1st and 2nd generation cephalosporins have little or no activity against Ps. aeruginosa, therefore

laboralories should nut be testing this organism against these antibiotics. Amongst the 3rd generation cephalosporin, resistance to ceftazidime was the lowest i.e. 6.5%. Resistance to perfloxacin were 1 5.8%.

d. Klebsiella spp - It is well known that almost all Klebsiella

spp are resistant to Ampicillin. - Resistance to the cephalosporins were

higher than E. coli, 21.10% were resistant to Cephalexin, 13.0% to Cefuroxime and 9.9-1 8.8% to the 3rd generation cephalosporins.

- Resistance to Gentamicin was 16.4% while resistance to Amikacin was 7.8%.

- Resistance to Perfloxacin, a quinolone was 3.9%.

e. Acinetobacter spp - A group of organism that has been gaining

importance as a causative organism in nosocomial infections as well as opportunistic infections generally showed higher resistance to most antibiotics. Resistance to imipenem is still quite low 3.8%.

f. Table I1 was specially designed to monitor the emergence of certain antibiotic resistance which was unusual in this country as well as for those bacteria that require special media to isolate. The PPNG rates were 47.2% Chloramphenicol and Ampicillin resistant H inflzienzne was low ie. 0.7 to 4.7%. Resistant to penicillin among the S.pneurnoniae were 0.2% (not verified). Although certain laboratories had reported penicillin resistant Group A and B streptococci, these results were not confirmed. Chloramphenicol resistant S.typhj were isolated in many states representing 4.6% of 1994 isolates. Tctracyclinc rcsistslnt Fcholerae wcrc not seen among the 1994 isolates.

Table I: National Surw Percentage of o

Acinetobacter spp

Citrohacter qpp

Enterobacter spp

Escherichia coli

Klebsiella spp

Morganella morgnnii Proteus spp

Pseudomonas aeruginosa Pseudomonas spp

Salmonella spp

Shigella spp

Serratia spp

Sraphylococcus aureus MRSA

Staph epldermld~s Coagulase negatwe staph Group A Streptococcus Group B Streptococcus Streptococcus pneumonlae Enterococcus

80.2 38.1 (24841 (687) 8 7 7 1 7 3 (490) (98) 83.6 12.6 (2136) (467) 60.2 5.8 (7255) (1383) 94.3 16.6 (6304) ( 1535) 84.6 1.7 (267) ( 5 8 ) 50.5 1.4 (1282) (289)

7.1 (1686) 34.0 (606)

5.1 (455) 9.0 ( I l l ) 36.4 (22) 8 1 4 9 6 (199) (52)

Note. No. - % o f Resistance - not conf~rnisd

(No.) -Total no. tested against the antibiotic

lance of Antibiotic Resistance 1994 ;anisms Resistance to Antibiotics

Table I1 - National Antibiotic Specific Bacteria (Jan-Dec

- Hospttal

Perlis A.Setar Penang Ipoh K.Bahru K.Terengganu Kuantan Organisms -

Saureus (MRSA)

N.gonorrhoeae (PPNG)

N.gonorrhoeae (Spectinomycin R)

H. influenzae (Chloramphenicol R)

H. influenzae (Ampicillin R)

S. pneumoniae (Penicillin R & relatively R)

S.Typhi (Chloramphenicol R)

V.cholerae (Tetracycline R)

Grp. A Strept (Penicillin R)

Grp. I3 Strept (Penicillin R)

* : Not confirmed No. : % of resistance ( ) : total no. tested

Susceptibility Survey On 1994) : % of Resistance

Kelang K.Lumpur Seremban Melaka !.Bahru K.Kinabalu Kuching IMR All Hospital

'4 bstracts

IMR ABSTRACTS

Isolation of Moraxella catarrhalis from sputum specimens of Malaysian patients

Norazah A, Cheong YlM, HadiJah MT

Muluysian J Pathol 1994; 16(1):63-67

Moraxella catarvhalis has gained reputation as a pathogen in the lower respiratory tract especially in patients with underlying chronic lung diseases. It is considered sigificant when isolated from sputum specimens of adults with respiratory tract infections. A study was carried out to determine the prevalence of Moraxella catarrhalis isolated in sputum specimens and beta-lactamase production of these isolates. Sputum specimens sent to the Bacteriology Division, Institute for Medical Research from April 1990 until April 1993 were screened for Moraxella catarrhalis. A total of 1678 sputum specimens were processed and Moraxella catarrhalis was isolated from 15 (0.89%) of the sputum specimens. Six out of 15 (40%) were isolated from patients with chronic obstructive pulmonary disease. Beta-lactamase production should be tested on all isolates so that appropriate treatment can be given. All the isolates in this study were sensitive to cotrimoxazole.

Reference ranges for lymphocyte subsets in a defined Malaysian population

Dhuliwnl JS, Bnlasubramaniarn I: Quek CJ, Gill HK . Nasuruddin BA

The aim of this study was to establish the lymphocyte subset reference rangcs in a defined

Malaysia11 populatiorl as well as to determine inter-racial differences for these values. Normal blood obtained from 152 subjects (55.9% Malay, 26.3% Chinese and 17.7% India11) was immunophenotyped. Results obtained (expressed as mean +/- SD%), absolute count (x lo6 cells/ mm3) were as follows: CD3 :66.5+/-8.6% 2,066; CD4:33.2+/-8.5%, 1,028; CD8:3 1.6+/-8.9%, 982; CD19: 12.0+1-0%, 5,374 and CD56+CL) 1 6:2U.~+l-W'0, 1.638. There were no significant differences between the percent lymphocyte subsets of the three racial groups. However, the absolute number of CD4 cells and CD 19 cells in Chinese was significantly lower (pK0.05) compared to the Indian and the Indian and Malay groups respectively. Comparison of our results with other reports showed that the percentage of Natural Killer cells in this population is higher than that reported for Caucasian population.

Cytopathologic changes associated with intrauterine contraceptive devices. A review of cervico-vaginal smears in ,350 women

B.Pillay, AM Gregory, M.Szrbbiuh

Med. J Malaysia 1994;49: 74- 77

A retrospective study of routine PAP smears from 350 IUCD users was done to ascertain the type of abnormalities encountered in these women. Changes in the micrbial environment were noted with a high frequency of G. lfuginulis, Trichomonas vaginalis and Candida. leukocytosis, histocytosis, benign reactive1 proliferative changes, out-of-phase endometrial cells, irritated glandular cells, dysglastic squamous cells and bizarre single cells were the

Abstracts

other features obseived, of which the serious epithelial atypias need to be followed up.

Nucleotide and amino acid sequences in the Prem region of a Japanese Encephalitis Virus strain isula ted frum a pod of Aedes albopictus and Ae. butleri Mosquitoes captured in peninsular Malaysia in 1992

Indra Vythilingam, Kouichi Morita, Akira Igarashi

Tropical Medicine 1994; 36:51-56

One strain of the japanese encephalitis (JE) virus isolated from a pool of Aedes albopictus and Aedes butleri mosquitoes from Sabak Bernam, in Peninsular Malaysia in 1992 was sequenced for its PreM gene region, by direct sequencing the product from reverse transcriptase polymerase chain reaction (RT-PCR). The sequence in the length of 240 nucleotide (nt) and deduced amino acid (AA) sequence were compared with the published sequences for the various JE virus strains from different geographical regions. This virus strain MaSAr39692, showed a close homology to the strains from epidemic areas such as Japan, China, Taiwan, Sri lanka and India. The homology between MaSAr39692 and JaOAr982 strain, for which the entire genome sequence was first determined, was 95.8% with lOnt and 3AA sequence divergence.

Carotenoid profile and retinol content in human serum - simultaneous determination by high-pressure liquid chromatography (HPLC)

A reversed-phase HPLC mcthod developed for the simultaneous determination of carotenoids and retinol in foods of vegetable and animal vligin was applied to the study of 100 samples of human serum. The subjects were urban adult Malaysian of Malay, Chinese and Indian descent wilh a mean age of 52.8 years (range 17-78 years). For comparison, all serum samples were also simultaneously determined using the direct spectrophotometric method for carotenoids and the Carr-Price colorimetric method for retinol. Compared to the conventional methods, the HPLC methods was found to give significantly higher results for retinal and total carotenoid concentrations. The major advantages of the liquid chromatographic method are that it is more specific and that it overcomes the problems associated with the Carr-Price method. In addition, only the HPLC procedure could provide an account of the serum carotenoid profile, a knowledge of which is now of increasing health importance in view of the possible inverse association of carotenoid intake and some forms of cancer. Six major carotenoids - lutein, cryptoxanthin, lycopene, y-carotene, a-carotene and p-carotene - were quantitated, the most abundant being lutein and cryptoxanthin, each contributing to about one quarter of all the carotenoids quantitated. p-carotene and lycopene were the next abundant carotenoids, each contributing to about 20% of all carotenoids. y- and a-carotenes together made up about 10% of all .carotenoids detected and quantitated. The mean content of total carotenoids was 196.0+/- 83.2ug/dl, with no statistically significant difference between levels for female and male subjects. The mean serum retinol level was 74.2+/- 23.0 ugldl and none of the subjects in this study could be regarded to be vitamin A deficient.

Tee ES, Lim CL, Chong YH

lnternational J Food Sciences & Nutrition 1994;45:147-57

Cytokines

CYTOKINES

In 1932, Rich and Lewis made a very important observation while studying immunity in Tuberculosis. They noted a migration of mononuclear cells from spleen explants of guinea pigs that had been cultured in vitro for 24 hours. This migration, however, was not observed when the explant had been taken from a tuberculin sensitive donor and cultured in the prescence of tuberculin. Thirty years later, the phenomenon was analysed further and it was shown that a soluble factor, christened "Migration Inhibitory Factor", was responsible for this activity. During this period many similar factors ( MAF, LT, CF, SRF, etc ) were doclimented, co that the generic term "lymphokines" was coined to cover all these factors. More soluble factors, produced by other cells, were also discovered and these were variously referred to as monokines, interleukins and interferons depending on the cell which produced them and on their activity. A rneasure of order was brought to this field when recombinant DNA technology made it possible I ) to dcvelop a systematic nomcnclaturc bascd on the identification of the DNA sequence of a factor and its biological activities, and 2 ) to develop assays for these factors. It was also decided that as these factors were produced by a variety of cells, a more appropriate collective Lerm fur Llierri would be "Cytukines".

Cytokines are low molecular weight proteins released by activated cells mediating an immune or inflammatory response. Whilst the group embraces several factors which mediate a variety of biological activities, they do possess some unifying characteristics. Cytokines act locally, in contrast to endocine secretions. They are very potent substances acting at picomolar

concentrations. Cytokines bind to specific receptors on cells and once this binding takes place, the cell alters its activities accordingly. Cytokines are pleiotropic, that is to say that a cytokine can mediate several biological effects. Like the genetic code they are also degenerate, ie. several different cytokines mediate the same effect. In addition, cytokines act in a network manner, so that their joint effects maybe additive, synergistic or antagonistic. Cytokines have a very short half-life. eg. Interleukin-2 (IL-2) has a half- life of between 7 and 10 minutes. Finally, it is important to note that the control mechanisms, which would he mandatory for such potent substances, are actually inherent in the characteristics described here.

The early assays for cytokines were biological assays. The biological assay for Interleukin-2 (1) is based on its ability to promote the growth of a murine cytotoxic T cell line (CTLL). The assay thus involves the addition of serial dilutions of thc tcst samplc to a standard number of cells. Proliferation of these cells as measured by the incorporation of tritiated thymidine, would indicate the prescence of IL-2. Sincc, wc now know that several cylokines can mediate the same biological effects, these assays are not definitive. The establishmeril of n~vrioclur~al arltibudics against these cytokines has enabled the development of definitive assays using the ELISA technique. This is the method we are using. at the IMR, to detect cytokines both in the supernatants of cultured cells as well as in biological fluids taken from patients. These monclonal antibodies coupled to varlous visualising agents may also be used to detect cytokines and their receptors in situ. It is also

Cytokines

possible to detect the expression of the gene for various cytokines using a combination of PCR and hybridisation, for the unequivocal identifi- cation of the cytokines produced by a particular cell (2). In fact, this is the method used to determine whether a THl , TH2 or THO type cell is involved in a particular situation. We are trying to establish this method,in the IMR, to detect cytokine production in particular ceIls. In so far as the detection and measurement of cytokines is concerned, it has been our experience, that 1) the choice of sample taken is critical given the local action of these substances, and 2) the sample must be treated with care as these substances are very labile.

It has become increasingly apparent that cytokines play an important role, hoth, in the maintenance of a normal physiological state and in disease. There are essentially two situations which allow us to assess the role of cytokines in disease. The first occurs when the normal control mechanisms fail to operate so that the release of cytokines continues unchecked, and the second type of situation occurs when the release of cytokines or their action is abrogated. Two cxamplcs of the first situation are sepsis and meningitis. It must be made clear that in these examples, cytokines are a normal part of the i lehct : arsenal. However, an unexpected turn of events in the course of the disease and serious sequelae, in the face of adequate treatment, maybe a consequence of the uncontrolled production of cytokines. Following this tack of reasoning, several biotechnology companies have been investigating the possibility of an anti- cytokine therapy for sepsis (3). Although clinical trials have so far been discouraging, the approach has not been abandoned. Two examples of the second type of situation, when the normal production or activity of cytokines is abrogated, are lepromatous leprosy and Chagas' disease. In lepromatous leprosy, the patient's cells do not produce the cytokines IL-2 (4) and Gamma- Interferon (5) upon encounter with M leprae.

Small scale trials have been conducted in which a course of exogenous IL-2 was administered to LL patients with very encouraging results especially in decreasing the bacterial load (6). In Chagas' disease, T. cruzi induces a state of severe immune suppression in the host. This supression has been shown to be due to the inability of the host's cells to bind IL-2 as they are unable to produce functional receptors for thls cytokine (7). Examples of both types of situations are being studied here at the Immunology Division, IMR.

The role of cytokines in meningitis, an example of the first type of situation, is the subject of a collaborative study with the Paediatric Institute, Kuala Lumpur Hospital. The second type of situation is being studied in collaboration with the National T .eprosy Control Centre. Tn this shdy we are looking at the production of cytokines in response to M. leprae in various subjects.

Cytokine therapy is a very exciting proposition. However, the very nature of these molecules places severe limitations on their use for this purpose. First, the short half-life of cytokines and their local mode of action make it very difficult to sinlulate physiological concentrations. In order to surmount these constraints, treatment regimes based on the continuous intravenous infusion of IL-2, for up to eight hours, have been concieved in the treatment of certain tumours such as melanoma. These regimes have brought us up against, the other constraint in cytokine therapy, their side effects. These side effects range from the acceptable ie. fever, chills, vomiting and diarrhoeae, to the uncceptable, ie. respiratory distress and coma. There are many strategies to surmount these constraints. Two strategies which have been tried, with varying degrees of success are 1) the intralesional administration of the cytokine and 2) the transfection of homologous cells with the gene for the cytokine. With the ingenuity that is always apparent when a problem calls for a solution, it seems certain that the constraints in cytokine therapy will one day be

Cytokines

surmounted. But for now, it is important to remember that the authors who worked on the IL-2 trial in lepromatous leprosy were cautious in their promotion of this kind of immunotherapy on the grounds that our knowledge and experience in this field is limited.

References

1. Gillis S, Ferm MM, Winey 0 and Smith KA . T cell growth factor : Parameters of production and a quantitative microassay for activity. J. of Irnmunol 1978;120: 2027- 2032

2. Salgame P, Abrams JS, Clayberger C, Goldstein H, Convit J. Modlin RL and Bloom BR. Differing lymphokine profiles of functional subsets of human CD4 and CD8 T cell clones. Science 1991;254: 279-282

3 . Stone R . Search for Sepsis drugs goes on despite past failures. Science 1994;264: 365-367

4. Haregewoin A, Godal T, Mustafa AS, Belehu A and Yemaneberhan T. T-cell conditioned media reverse T-cell unresponsiveness in lepromatous leprosy. Nature 1983;303 : 42-44

5. Nogueira N, Kaplan G, Levy E, Samo N, Kushner P, Granelli-Piperno A, Yip YK, and Cohn ZA. Defective Interferon production in leprosy. Reversal with antigen and IL-2. J . Exp. Med. 1983;158 : 2165-2170

6. Kaplan G, Kiessling R, Hancock G, Teklemariam S, Sheftel G, Job CK, Converse P, Ottenhoff THM, Becs- Bleumink M, Dietz M and Cohn ZA . The reconstitution of cell mediated immunity in the cutaneous lesions of lepromatous leprosy by recombinant interleukin-2. J. Exp. Med. 1989;169 : 893-907

7. Kierszenbaum F, Sztein MB and Beltz LA . Decreased human IL-2 receptor expression due to a protozoan pathogen. Imrnunol. Today 1989; 10 : 129-13 1

Thesis

STUDIES ON ALKALOIDS AND ANTITUMOR ACTIVITY OF HUNTERIA ZEYLANICA

/ c- i Latiji~h Ibrahim

(Abstract of thesis submitted to the University of Malaya by Latifah Ibrahim for the degree of Master in Biotechnology)

The relationship between man and plants have always been closed since the beginning of human civilation. For thosands of years, plant materials have been used for relieving pains and for curing various kind of diseases. Malaysia as part of the tropical Rain Forest Biome is extremely rich in plant species, among which are those which possess high potential to be developed into modem drugs and other pharmaceutical products. However the use of reasonably pure chemical as extracted from plants have been a relatively new phenomenon, dating back to about four centuries ago. Since then, various attemps have been made through various studies to explore these natural products for medicinal potential and translate them into new7 uses and applications in the fields of phytochemistry and pharmacologically active compounds.

Phytochemical studies is one of the most effective way to discover the medicinal potential of various chemical potentials derived p lank . Prelimanary phytochemical studies yield valuable informations on secondary metabolites of plant extracts. These includes alkaloids, flavonoids, anthraquinones, tannins, saponins, cardiac glycosides and phenolic compounds. These compounds are then investigated for their medicinal potential where their biological activities are determined. Among the compounds mentioned, the alkaloids have been the most extensively studied. More than four thousands alkaloids have been isolated and the stuctures elucidated during the past two decades.

The main aspect of this study is to determine the secondary metabolite compounds of the stem of Hunteria zeylanica (Retz) Gardn., from the Apocynaceae family. Due to the interest of alkaloids and the lack of studies on terpenoids of Apocynaceae family, this study is carried out to mainly concentrate on the isolation and stuctural elucidation of these group of compounds. The biological asssay for antitumour activity are also determined by in vitro cytotoxicity of the plant extracts and latent Epstein-Barr Virus (EBV) inhibition technique in Raji cells.

Initially, the stem and leaves of this plant were extracted using light petroleum ether, hexane, chloroform and methanol as solvents. Only the stem of the woods of this plant was eventually studied. Phytochemical screening was conducted on thin layer chromatography (TLC), to determine the presence of secondary metabolites. The presence 01 alkaloids and terpenoids were detected using Dragendroff's and Vanilin/H,SO, reagents, respectively.

The acid-base extraction was carried out to obtain the crude alkaloids. The crude alkaloids. and terpenoids of this species were chromatographed over a silica gel column followed by preparative TLC. In this studies, three alkaloids were isolated and their structures were elucidated by spectroscopic methods such as Gas chromatograph Mass Spectrometer (GCMS) and 'NMR.

From the stem of Hzrnteria zejdanica, three pure compounds were successfully isolated and identified as 1,2-didehydroaspidospermidine, eburnamine and eburnamenine. The petroleum ether and chloroform extracts showed antitumour activity against SP-2 (mouse myeloma) and Raji (Burkitts lymphorma ) cells. The petroleum ethcr extract gave IC,, of 3.4 ug/ml on SP-2 cells and the chloroform extract gave IC,, of 16 uglml on Raji cells and weak antitumour activity against SP-2.

Bioassay guided isolation showed that the active component was 1,2-didehydroaspidosperrnidine with IC,, of 20uglml for SP-2 cell culture. However, this compound did not show antitumour activity against Raji cells. These results indicate that there could be other compounds in the chloroform and petrolcum cther extracts which have the antitumour activity. Petroleum ether extract of H, zeylanica inhibited the growth of Raji cells when tested at concentrations of 4 to 32 uglml. However, none of the other fractions of H. zeylanica extracts slivwed Epstein- Barr Virus activating principles.

Gen Beta bloom

PENGESANAN MUTASI PADA GEN BETA GLOBIN

Dalam individu dewasa normal, jumlah peratusan Hb A (u,, P,) ialah 94%, Hb A, (u, 7,) 2 5 3 . 5 % manakala ~b F (a, y,) adalah kurGg dari 2.5%. Hemoglobin utama dalam fetus ialah Hb F tetapi ia akan berkurangan apabila meningkat dewasa. Gen beta globin merupakan kod genetik untuk rantai protein globin dalam molekul Hb A bagi orang dewasa. Mutasi gen ini membawa kepada kejadian keabnorrnalan kadar sintesis beta globin. Penurunan kadar sintesis beta globin telah disabitkan dengan penyakit beta talasemia. Kajian yang dilakukan di Malaysia menunjukkan bahawa pada kes-kes beta talasemia major tiada langsung dapat dikesan rantai beta dan ianya berkait terus dengan kekurangan jwnlah molekul mRNA beta globin. Di Malaysia 14 jenis mutasi gen beta globin dapat dikesan. Kajian awal terhadap 15 kromosom gen beta globin di Malaysia menunjukkan 50% mutasi adalah jenis penggantian bes dan 20% adalah jenis delesi empat bes.

Mutasi penggantian bes boleh dikesan menggunakan kaedah penglabelan proba oligonukleotida sintetik. Proba oligonukleotida direkabentuk samada mempunyai struktur yang sama (proba normal) atau berlainan (proba mutan) dengan DNA sasaran yang dianalisa. Pengesanan ini adalah melalui penghibridan, di mana ia membenarkan perlekatan proba oligonukleotida kepada DNA sasaran hanya jika kesemua nukleotidanya benar-benar kompli- mentari. Jika satu nukleotida berlainan, tidak berlaku penghibridan. Penentuan samada penghibridan berlaku atau tidak ialah rnelalui pengesanan secara radioaktif atau nonradioaktif. Dekad 90-an, pengesanan melalui teknik

radioaktif jarangltidak lagi dilaltukan kerana ianya tidak stabil, berbahaya, dipengaruhi oleh jangkahayat radioaktif, masa hibridisasi dan pendedaban ke fileill x-ray yang lama dan membran tidak boleh diulangpakai kerana pel-lekatan antara proba dan DNA sasaran adalah sangat kuat hingga sukar untuk dipisahkan. Berbanding dengan kaedah nonradioaktif di mana ia lebih selamat, stabil sehingga 3 bulan, masa hibridisasi dan pendedahan yang singkat dan membran boleh diulangpakai. Dalam kajian ini kami telah menggunakan kaedah non- radioaktif melalui penggunaan Enhance Chemiluminescein (ECL) System.

Bahan dan Kaedah

Kajian ini melibatkan seramai 44 orang pesakit beta talasemia major dari Hospital Ipoh, Seremban dan Melaka. Sebanyak 7 ml darah diambil dari setiap pesakit ini seterusnya dilakukan ekstraksi DNA. Selepas ketulenan dan kepekatan DNA diketahui, amplifikasi 3 kb gen beta globin dilakukan menggunakan teknik Polymerase Chain Reaction (PCR), mengikut kaedah yang telah diubahsuai daripada teknik Fuchareon (1 989). Ampli fikasi menggunakan sepasang primer G9 (TCCCAAGTTAACCTCCTATT) dan G I 0 (AGACTAGCACTGCAGATTCC). Pengesanan saiz 3 kb dilakukan menggunakan 1 % kepekatan gel agaros. Apabila telah terbukti saiz 3kb tersebut, proses dot-blot dilakukan. Dot-blot dilakukan ke atas dua keping membran nylon melalui proses denaturasi 1 5 ul produk PCR pada suhu 95OC selama 15 min. Ia disejukkan serta- merta dalam ais da diikuti dengan penambahan 15 ul 20x SSC. Scbclum dilnkukan dot blot kc

Gen Beta Clobin

atas membran, kedua-dua rnembran dilernbabkan dengan l o x SSC. Apabila membran yang mengandungi DNA telah kering, membran diderialurasikari secara alkali dengan 1.5M NaC1, 0.5M NaOH pada suhu bilik selama 5 min dan dineutralkan dengan 1.5M NaC1, 0.5M Tris-C1 pH 7.2, 0.001 M EDTA pH 8.0.

Selepas kesemua 3 kb DNA pesakit yang mengandungi gen beta globin dilakukan dot-blot, ia diikuti dengan proses hibridisasi secara nonradioaktif. Proses hibridisasi dan pengesanan isyarat penghibridan adalah berdasarkan kepada tindakbalas ECL menggunakan prosedur seperti yang disyorkan oleh kit Amersham. Satu membran nylon dihibridkan dengan proba normal dan satu lagi dengan proba mutan. Proses hibridisasi ini memakan masa lebih kurang 2 jam dan suhu bergantung kepada jenis mutasi yang ingin dikesan. Selepas pembasrhan kedua-dua membran, pengesanan isyarat penghibridan proba dan DNA sasaran dilakukan melalui pendedahan kedua-dua membran kepada filem x-ray. Pendedahan ke filem xtray memakan masa 1-2 minit sahaja diikuti dengan pemprosesan filem x-ray dalam developer dan fixer. Pendedahan dan pemprosesan filem dilakukan dalam bilik gelap. Rajah 1, menunjukkan ringkasan proses kerja projek ini.

7 ml sampel darah pesakit -thalassemia dalam tiub EDTA

I Ekstraksi DNA

I PCR

I 1% Gel agarose

I Dot-blot

I Hibridisasi dengan proba normal dan mutan

I Pengesanan atas filem autoradingrafi

-

Rajah 1. Carta alir ringkasan kerja pengesanan mutasi pada gen Beta Globulin melalui teknik

Enhanced Chemiluminescein

Perbincangan dan Keputusan

Penentuan samada pesakit itu adalah homozigot atau hetero~igol pada mutasi tersebut adalah berdasarkan keputusan daripada kedua-dua filem normal dan mutan. Jika spot hitam kelihatan pada filem mutan sahaja dan tiada pada filem normal ini menunjukkan mutan homozigot. Jika spot hitam kelihatan di kedua-dua filem, ini menunjukkan mutan heterozigot. Manakala jika spot hitam hanya kelihatan pada filem normal sahaja ini menunjukkan pesakit tersebut adalah normal pada mutasi itu. Bagi pesakit yang normal pada titik yang dikaji maka ujian seterusnya melalui penggunaan proba lain dilakukan. Rajah 2 adalah satu contoh keputusan penggunaan proba bagi mutasi pada kodon 4 1/42 bagi pesakit beta-talasemia major. Suhu lubridisasi bagi proba ini ialah 53°C. Proba mutan dan normal bagi kodon 4 1/42 menunj ukkan 6 pesakit adalah homozigot, 10 adalah heterozigot manakala yang lain adalah normal.

Kesimpulan

Kaedah pengesanan mutasi pada gen beta globin melalui teknik nonradioaktif telah berjaya mengesan mutasi pada kodon 4 1/42. Daripada 88 kromosom yang dikaji 22 kromosom menunjukkan mutasi pada kodon 41/42. Tni menggambarkan 25% ale1 Beta talassemia merupakan mutasi pada kodon 4 1/42.

Rujukan

1. Fucharoen, S., Fucharoen, G., Fucharoen, P., and Fukumaki, Y. (1989) A Novel Ochre Mutation in Beta- Thalassemia Gene of a Thai. J. Biol. Chem. 264: 7780- 7783

2. Fucharoen, S., Fucharoen, G., Ata, K., Aziz, S., Hashim, S., Hassan, K., and Fukumaki, Y. (1990) Molecular Characterization and Nonradioactive Detection of Beta- Thalassemia in Malaysia. Acta Heamatol. 84: 82-88

Cen Beta Globin

3. Saiki, R. K., Scharf, S., Faloona. F., Horn, K.B .M.G.T., 4. Yang, K.G., Kultar, F., George, E., Wilson, J. B., Kultar, Erlich, H. A., and Arnheim, N. (1985) Enzymatic A,, Stoming, T. A,, Gonzalez-Redondo, J. M., and Huisman, Amplification of Beta- Globin Genomic Sequences and T. H. J . (1989) Molecular Characterization of Beta- Globin Ristriction Site Analysis for Diagnosis of Sickle Cell Gene Mutations in Malay Patients with Hb E- Beta- Anemia. Science. 230: 1350-1354 Thalassaemia and Thalassaemia Major. British Journal of

Haematology. 72: 73-80

Proba normal pada kodon 4 1/42

Proba mutan pada kodon 4 1/42

Rajah 2. Contoh keputusan hibridisasi dot blot terhadap 3 kb DNA gen beta globin dengan proba normal dan mutan pada kodon 41/42. Nombor sarnpel disusun dari arah kiri ke kanan. Sampel5, 11,

23, 25,26 dan 41 adalah homozigot manakala sampel2,3,4, 8, 12, 13,24,29,43 dan 44 adalah heterozigot.

Lambornella stegomyiae

f DISTRIBUTION OF LAMBORNELLA STEGOMYIAE

IN CONTAINER BREEDING MOSQUITOES IN MALAYSIA Indra Vythilingam

Lambornella stegomyiae Lamborn is a facultative parasitic, ciliated protozoan, belonging to the family Tetrhymenidae. L. stegomiyae, was first found in a batch of 29 Aedes albopictus larvae breeding in an earthernware pot in Kajang, Malaysia in 1920 (1). This parasitic ciliate has been reported from widespread geographical areas such as Africa, Europe, Southeast Asia, USSR and USA. Although most were found breeding in Aedes species, there have been reports of it in the culicine species of Armigeres, Ctdiseta, Wyeomyia and Anopheles.

Besides L. stegomyiae, L. clarki, a species that has been found in Aedes .rierren.ri.v breeding in tree holes in California, is the only other known Lambou.nella species. The life cycle of the free- living forms and the resting cyst stages of L. stegomyiae has not been extensively studied. However it is known that the cyst attaches itself on the surface of the mosquito larva il; the form of a round transparent structure. The ciliate then gains entry into the hemocoel and rapid multipli- cation takcs placc. Thcy fced on the haemolympli of the host and thus cause death to the larva. The cuticle of the larva ruptures and the ciliates escape iutu the water arid inlecls new larvae.

Thus. although it seems that Lambornella could be a potential biological control agent, very little work has been carried out in this field. Since its discovery in 1920, it was next found only in 1990, in Penang (2).

Because of this paucity of data, a survey was carried-out in all states of Peninsular Malaysia, except Penang. All types of artificial containers, bamboo stumps and tree holes were examined for larvae.

A total of2,896 collections were examined and of these 133 were found to be positive for L. stegomyiae. The central region of Selangor and Negeri Sembilan had the highest percentage positive, this was followed by the north western region of Perak, Kedah and Perlis. L. stegomyiae was present in all states with the exception of Trengganu.

Most of the L. stegomyiae were found in latex collection cups in rubber estates. Aedes albopictzrs was the main species in which L.stegomyiae was found breeding. It was also found in Armigeres species. From our surveys it seems that L. stegomyiae will survive only in undisturbed habitats. It was found more in the rural areas than in the urban areas. Ae. albopictta is also more rural in its habitat compared to Ae. aegypti. This would explain why it was found in Ae, albopictus and not in Ae. aegypti. In some containers there was mixed breeding of Ae. albopictus and Armigeres, and L. stegomyiae was found in both species in such situations.

The in vitro culture of L. slegomyiae has been attempted but it has not been successful; they, however, survive in in vivu cultures ~ U I surr~ctirrie. If L.stegomyiae could be cultured in vitro in the laboratory (like L. clarki), it may then be possible to use it as a biological control agent for the control of container breeding mosquitoes especially Ae. albopictus.

References

1. Lamborn, W.A. A protozoan pathogenic to mosquito larvae. Parasitology 192 1 ; 13: 2 13-2 15

2. Sulaiman, 1. 1992. Natural pathogens of Aedes albopictzrs in Penang, Malaysia. Paper presented at X 1 1 1 th International Congress for Tropical Medicine and Malaria.

Micro wave

MICROWAVE RADIATION AND LIFE

Mohd Khadri S

The term "microwave radiation" is used to designate the portion of electromagnetic radiation spectrum which lies between frequencies of 300 and 300,000 MHz, which correspond to wavelengths in air of I m to 1 mm. This designation is accepted in most European countries. Similar definitions are used in American literature, although the United States of America Standards Institute considers the frequencies 10 and 100,000 MHz as the boundaries of the microwave region(1).

Comprehensive stuaies on microwave radiation have been conducted by researchers in Russia, Poland and the United States. Many of these studies addresed the problems of the biological effects of microwave and their health-hazard implications. Microwaves are used in TV transmitters, microwave ovens, radar and cellular communications. Recently, thc Malaysian Ministry of Health banned the use of cellular phones in designated areas in government hospitals owing to the possible i n t e r f ~ m ~ c e uf microwaves on sensitive medical equipment.

Oric rrlliy casily wonder why such importance is attached to the microwave region, which constitutes only a narrow part of the whole, broad, non-ionizing radiation spectrum. There are several reasons. Chronologically, microwave generators were the first nonionizing radiation source that permitted the emission of focused beams of very high energy density. During World War 11, the technique of radio-location developed rapidly because of military requirements; this was followed by amazingly fast progress in microwave techniques. During the last 30 years, industrial applications of microwave techniques

expanded greatly, and microwave radiation heating entered into common use. Microwave ovens, for example, have invaded private homes(1).

A wide range of studies on microwave radiation have been conducted since the late 1960s(l). It has been shown that microwave radiation could induce aberration of normal chromosomes(2,3) although microwave has been classified as a non- ionizing radiation(4). Baranski and Czerski (1) however, also questioned the biological effects of microwave irradiation which they thought was an unclear phenomena shrouded in mystery.

The potential risks of microwave should alert health personnel to examine the possible effects on microwave on the living system. The Division of Medical Entomology, IMR has begun conducting research into the effcct of microwaves on insects.The first attempt was made in early 1994. Microwave radiation (2450 MHz) induced a 50% rrrvrtality 01 [he Gerrnan cvckrwch (Blattella germanica) when exposed for 7 seconds. Exposure up to 2 seconds and 15 seconds gave mortalities of 25% and loo%, respectively. However, in the survivors, the susceptiblity toward cypermethrin (a synthetic pyrethroid) increased signiiicantly (5). F1 and F2 progenies hatched from irradiated German cockroaches oothecae were also tested and the results showed that the irradiated susceptibility status were also high compared to the control (5). These preliminary observations indicate that radiation from microwave may induce genetic changes in insects. Observation on the susceptibility status of irradiated Aedes larvae also showed an increased susceptibility towards

Micro wave

temephos (unpublished data). The American cockroach, Periplaneta americnna was observed for its insecticide susceptibility and neurological status after irradiation. Exposure of l! americana for 2,3,4 and 5 seconds to microwave irradiation caused 0%, 20%, 60% and 100% mortality, respectively, for up to five days post-exposure. k t 3 second exposure to microwave irradiation, their susceptibility status towards cypermethrin also increased compared to the control (un- irradiated). Neurological observations indicate that a number of dorsal unpaired neurones was "lost'' in irradiated American cockroach compared to the control, although physically they appeared to be normal (unpublished data).

The use of insects as a model is extremely advantageous due to their short life cycle and high fecundity rates. They can also be manipulated more easily than other multicellular organisms. It is hoped that the use of insects may flirther advance studies on the potential health hazards of microwave in our environment.

References

1 . Baranski, S. and Czerski, P. (1 976). Biological Effects ofMicrowaves. Published by Dowden, Hutchinson & Ross, Inc. Stroudsburg, Pennsylvania, U.S.A.

2. Deschaux, P.; Douss, T.; Santini, R.; Binder, P. & Fonlages, R. EKec;t of nlicr-owave irradiatiun (24500 MHz) on murine cytotoxic lymphocyte and natural killer (NK) cells. Journal Microwave Power 1984; l9(2): 107- 1 10.

3. Lloyd, D.C.: Saunders, R.D.; Finnon, P. & Kowalczuk, C.I. No clastogenic effect from in vitro microwave irradiation of GO human lymphocytes. International Journal Radialiurl Bivlogy Relativ~l Studies Physics Chemistry Medicine 1984;46(2): 135-141.

4. Suess, M.J. and Benwell, D.A., (eds.) . Nonionizing Radiation Protection. World Health Organization Regional Office for Europe, Copenhagen, WHO Regional Publication, European Series, 1986;No. 25.

5. Khadri, M.S. &Lee, H.L. Effects ofmicrowave (2450 MHz) radiation on Blattella germanica (L.) (Blattilidae). Accepted for publication in Tropical Biomedicine 1995.

Leukemias

THE EPIDEMIOLOGY OF LEUKAEMIAS

Leukaemias are serious blood disorders and can be classified into two major groups, acute and chronic. Acute leukaemias are divided into two main groups: acute lymphoblastic leukaemia (ALL) and acute myeloid leukaemia (AMT.). The incidence of leukaemias worldwide is about one per 100,000 per year. A similar incidence is found in Malaysia (1 ). Hnpital rec,ords reveal that neoplasms (cancers and leukaemias) are the second major cause of mortality in Malaysia(2).

In most types of leukaemia there is a male predominance. The incidence of leukaemia among Jews is higher than among other ethnic groups. Leukaemias differ in their incidence by age. AML represents the majority of acute leukaemias in adults and there is a trend of increasing incidence with age. ALL occurs frequently in childhood with a sharp age peak at 3-4 years. Thc sharp agc pcak is also obscrvcd in Malaysian children with ALL (3).

Exposurc to ionising radiation, chemical carcinogens, alkylating agents from the environ- ment. or during treatment of certain malignancies, can lead to the inductiuri uf certain types uf leukaemia. The incidence of chronic myeloid leukaemia (CML) in Hiroshima and Nagasaki increased tremendonusly some years after the atomic bombing of both cities. The incidence of CML was 2.6 times higher from the Hiroshima atomic blast than from the Nagasaki blast and 4 times greater in people receiving more than 100 rem, while the rate of acute leukaemias was approximately the same as before the bombing(4).

Benzene has been known to be etiologically related to the high incidence of leukaemia and aplastic anemia in people occupationally exposed to it. Exposure to other organic solvents such as toulene, xylene, petrol, and diesel might be leukaemogenic. Patients treated with irradiation or alkylating agents or both for carcinoma of the breast, ovary or lung, Hndgkjn's diseace. and non-Hodgkin's lymphoma have a higher risk of developing secondary leukaemia. Although most of the acute leukaemias associated with occupational exposure to organic solvents are of the AML type, epidemiological studies indicate that such exposure may also increase the risk of lymphoproliferative disorders such as ALL, non- Hodgkin's lymphoma, Hodgkin's disease and myeloma. A seven-fold increased risk of ALL has been observed in workers exposed to solvents ( 5 ) .

Some types of leukaemia may be etiologically related to cigarette smoking. The risk of AML i~meases with the number of cigai-ettes smoked daily and the duration of cigarette smoking (6). The evidence relating leukaemia to non-ionizing radiation such as ultra-sound, ultraviolet and electromagnetic radiation is still inconclusive.

The gene responsible for neurofibromatosis type 1 (NFI) belongs to the class of heritable cancer gene. Children with NFI show an increased incidence of myeloid leukaemia, including juvenile CML and, perhaps, the myeloproliferative syndrome associated with monosomy 7 (7). Down syndrome is associated with an increased incidence of acute leukaemia,

Leukemias

which is lymphoid in 70% of the cases. Congenital syndromes such as Fanconi's anemia, Bloom's syndrome and ataxia telangiectasia are also associated with an increasesd incidence of leukaemia.

Clustering of multiple cases of leukaemia within a single family is rare, with a frequency of 0.23% to 0.96% of all leukaemia casses (8). Siblings of children with acute leukaemia have approxi- mately two- to four-fold greater risk of developing the disease compared to unrelated children in the general population. When a patient with an identical twin develops acute leukaemia before 6 years of age the risk in the other twin is 20%. Leukaemia usually develops in the co-twin within a few months of the index case. Concordance leukaemia in twins supports the 'intra-placenta metastasis hypothesis' that the leukaemogenic event must have arisen in utero in urie twin arid the abrlurrrlal cells r~lelastases tu the other twin through placental anastomosis (9). In immunophenotyping studies done at the IMR, two monozygotic twins who develop concordant childhood ALL were found to have blast cells expressing the same antigens with almost similar percentages of positivity, thus suggesting that the leukaemia cells of both twins originated from the same clone. This probably supports the 'intra- placenta metastasis hypothesis' that the abnormal cells from one twin spread to the other twin via placenta anastomosis.

The Epstein-Barr virus (EBV) is associated with Burkitt's lymphoma. The EBV infects B lymphocytes. The T-cell lymphotropic virus I (HTLV-I) and human T-cell lymphotropic virus I1 (HTLV-11) are closely related retroviruses. The HTLVs are endemic in Africa, the Carribean Islands and in southwest Japan, but now tend to spread through the intravenous drug user population in the U.S.A. and in some countries in Western Europe. HTLV-I is associated with adult T-cell leukaemia/lymphoma and tropical

spastic paraparesis. HTLV-11 infection has uncertain clinical consequences. Transmission of HTLV-I, which may require passage of infected cells, occurs through breast feeding, semen, blood products, and by needles exchanged among intravenous drug abusers. Primary infection with EBV and HTLV-I is entirely asymptomatic, and about one percent of infected individuals develop lymphoid malignancy. Roth ERV and HTLV-I are capable of immortalizing cells in vitro (10).

There is an increasing epidemiologicd evidence that 'non-.specific7 infections are implicated in childhood ALL. Such infections may be of two types: a nominal range of certain viruses, or any infection which might stimulate the immune system of the developing child at certain critical times.

Thus, although studies on the epidemiology of the leukaemias cover diverse approaches and widely differing interpretations, yet the etiology of these diseases still remains obscure.

References

1. Dasgupta A, Noram1 MN, Jamaruddin M, Jackson N. Incidence and cell surface immunophenotype of acute leukaemias in Kelantan. Asia-Pacific J Mol Bio Biotech 1995; 7.170-4.

2. Annual Report 1989. Ministry of Health, Malaysia.

3. Sinniah D, Lin HP. Malaysian childhood leukaemia, thirteen year review at the University Hospital, Kuala Lumpur. Leukaemia Res. 1981; 5: 271-8.

4. UnitedNations General Assembly: Report of Scientific Committee on the effects of atomic radiation. 27th session, 26 Sept, 1972 A/ 8725.

5. Brandt L. Exposure to organic solvents and risk of haematological malignancies. Leukaemia Res 1992; 16: 67-70.

Leukemias

6 . Brownson RC, Chang JC, Davis JR. Cigarette smoking and the risk of adult leukemia. Am J Epidemiol 199 1 ; 134: 938-41.

7. Shannon KM. Watterson J, Johnson P, et al . Monosomy 7 myeloproliferative disease in children with ~~eurofibromatosis type I: Epidemiology and molecular analysis. Blood 1992; 79: 13 11-8.

8. Kurita S, Kamei Y. Genetics of familial leukemia. Jpn Hum Genet 1969; 14: 163-79.

9. Clarkson BD, Boyse EA. Possible explanation of high concordance for acute leukemia in monozygotic twins. Lancet 1971; i: 699-701.

10. Ambinder RF. Human lymphotropic viruses associated with lymphoid malignancy: Epstein-Barr and HTLV-I. Hematol/Oncol Clin North Am 1990; 4: 82 1-3.

Further reading:

Cartwright RA, Staines A. Acute leukaemias. In: Epidemiology ofhaematological diseases : Part I, Fleming AF (ed), London, 1992, pp. 1 - 26.

Finch SC, Linet MS. Chronic leukaemias. In: Epidemiology of haematological disease: Part I, London, 1992, pp. 27-56.

Streptococcal infection

( STREPTOCOCCAL INFECTION AS SEEN IN I I BACTERIOLOGY DIVISION IMR 1

In June 1994 a killer bacteria that literally eats away the flesh of its victims caused alarm in the United States and Britain. The bacteria blamed for the outbreak of necrotizing fasciitis was known as haemolytic Streptococcus (BHS) Group A. It is a common throat pathogen that can be carried by about 10% of normal people.

In 1993 3 17 Str.eptococcus species were isolated in Bacteriology Division IMR. Majority of the isolates was BHS group G (44.8%) and only 64 (20.2%) were BHS group A (Table 1 j. Out of this 64,54.7% (35/6'4) were isolated from pus of localiscd supcrficial wound.

Table 1: Streptococcus species isolated i r ~ Bacteriology Division, IMR (1993)

Spec~es BHS BHS BHS BHS BHS BHS S. pneumoniae

The Streptococci were isolated from various specimens which included pus/swab from superficial wound/ulcer (1 49), pus from abscess (2). throat swab (11). ear swabs (12), vaginal swabs (16) sputum (8), urine (16) and blood (1).

More than half (87) of the Streptococci isolated from superficial infection belongs to BHS group G, representing 58.4% of its total number. This was followed by BHS group A (23.6%) and BHS group B (1 2.7%)

More than 40% of throat swabs and 25% of sputum also yield BHS group G. About 61 % of

BHS group A were isolated from pus and 34.4% from throat swab (Table 2). All the abscesses were due to BHS group A.

Streptococcus species including BHS group A is a common pathogen that cause skin and subcutaneous infection, however, necrotizing fasc,iitis is rare in Malaysia. Beta haemolytic streptococci group A or Streptococcus pyogenes is a capsulated bacteria. The capsule consists of hyaluronic acid while the cell wall contains protein M T R-antigens, lipoteichoic acid and a group of carbohydrate and mucopeptide. M protcin is thc major virulence antigen. Strains rich in the protein are resistant to phagocytosis by polymophonuclear leucocytes, multiply rapidly i r ~ fresh human blood and are capable of initiating disease. Strains lacking M protein are avirulent.

Based on M protein BHS group A can be divided into more than 80 serotypes. T protein antigen has no role in streptococcal virulence but useful as an epidemiological marker.

Table 2: Distribution of Streptococcus species isolated

Abscess

Throat swab

Ear swab

Blood I -

2

22

2

Vagmal swab

Sputum

U r ~ n e

Total L*

3

- BHS

B - 19

28

13

1

7

68 -

S. pnrumo niae

2

6

4

1

2

- 7h tdl

/ SIDANG PENYUNTING 1

Pengerusi Mohamad Taha Arif

Penasihat Josephine L. Fernandez

Penyunting Azizah Mohd. Radzi Amal Nasir J.B. Lopez

Penolong Mohd Fo'ad Kastarnam

Bangunan IMR - 1977

Bangunan IMR - 1901

Institut Penyelidikan Perubatan (Institute for Medical Research) Jalan Pahang 50588 Kuala Lumpur Ma1 aysia