bab v transkripsi

Download Bab v Transkripsi

Post on 09-Jul-2015

128 views

Category:

Documents

1 download

Embed Size (px)

TRANSCRIPT

BAB V. TRANSKRIPSI Pokok bahasan di dalam bab ini meliputi prinsip dasar transkripsi, yang mencakup ciri-ciri dan tahapan transkripsi, transkripsi pada prokariot, dan transkripsi pada eukariot, dengan penekanan pada karakteristik enzim RNA polimerasenya. Setelah mempelajari pokok bahasan di dalam bab ini mahasiswa diharapkan mampu menjelaskan: 1. prinsip dasar transkripsi, 2. transkripsi pada prokariot, khususnya pada bakteri Escherichia coli, dan 3. transkripsi pada eukariot. Pengetahuan awal yang diperlukan oleh mahasiswa agar dapat mempelajari pokok bahasan ini dengan lebih baik adalah struktur asam nukleat dan replikasi DNA, yang masing-masing telah dijelaskan pada Bab II dan Bab IV. Selain itu, konsep dasar tentang gen dan transkripsi yang telah diperoleh pada mata kuliah Genetika juga sangat mendukung pemahaman materi bahasan di dalam bab ini. Prinsip Dasar Transkripsi Pada Bab IV telah disebutkan bahwa fungsi dasar kedua yang harus dijalankan oleh DNA sebagai materi genetik adalah fungsi fenotipik. Artinya, DNA harus mampu mengatur pertumbuhan dan diferensiasi individu organisme sehingga dihasilkan suatu fenotipe tertentu. Fungsi ini dilaksanakan melalui ekspresi gen, yang tahap pertamanya adalah proses transkripsi, yaitu perubahan urutan basa molekul DNA menjadi urutan basa molekul RNA. Dengan perkataan lain, transkripsi merupakan proses sintesis RNA menggunakan salah satu untai molekul DNA sebagai cetakan (templat)nya. Transkripsi mempunyai ciri-ciri kimiawi yang serupa dengan sintesis/replikasi DNA, yaitu 1. Adanya sumber basa nitrogen berupa nukleosida trifosfat. Bedanya dengan sumber basa untuk sintesis DNA hanyalah pada molekul gula pentosanya yang tidak berupa deoksiribosa tetapi ribosa dan tidak adanya basa timin tetapi digantikan oleh urasil. Jadi, keempat nukleosida trifosfat yang diperlukan adalah adenosin trifosfat (ATP), guanosin trifosfat (GTP), sitidin trifosfat (CTP), dan uridin trifosfat (UTP). 2. Adanya untai molekul DNA sebagai cetakan. Dalam hal ini hanya salah satu di antara kedua untai DNA yang akan berfungsi sebagai cetakan bagi sintesis molekul RNA. Untai DNA ini mempunyai urutan basa yang komplementer dengan urutan basa RNA

48 hasil transkripsinya, dan disebut sebagai pita antisens. Sementara itu, untai DNA pasangannya, yang mempunyai urutan basa sama dengan urutan basa RNA, disebut sebagai pita sens. Meskipun demikian, sebenarnya transkripsi pada umumnya tidak terjadi pada urutan basa di sepanjang salah satu untai DNA. Jadi, bisa saja urutan basa yang ditranskripsi terdapat berselang-seling di antara kedua untai DNA. 3. Sintesis berlangsung dengan arah 5 3 seperti halnya arah sintesis DNA. 4. Gugus 3- OH pada suatu nukleotida bereaksi dengan gugus 5- trifosfat pada nukleotida berikutnya menghasilkan ikatan fosofodiester dengan membebaskan dua atom pirofosfat anorganik (PPi). Reaksi ini jelas sama dengan reaksi polimerisasi DNA. Hanya saja enzim yang bekerja bukannya DNA polimerase, melainkan RNA polimerase. Perbedaan yang sangat nyata di antara kedua enzim ini terletak pada kemampuan enzim RNA polimerase untuk melakukan inisiasi sintesis RNA tanpa adanya molekul primer. Secara garis besar transkripsi berlangsung dalam empat tahap, yaitu pengenalan promoter, inisiasi, elongasi, dan teminasi. Masing-masing tahap akan dijelaskan secara singkat sebagai berikut. Pengenalan promoter Agar molekul DNA dapat digunakan sebagai cetakan dalam sintesis RNA, kedua untainya harus dipisahkan satu sama lain di tempat-tempat terjadinya penambahan basa pada RNA. Selanjutnya, begitu penambahan basa selesai dilakukan, kedua untai DNA segera menyatu kembali. Pemisahan kedua untai DNA pertama kali terjadi di suatu tempat tertentu, yang merupakan tempat pengikatan enzim RNA polimerase di sisi 5 (upstream) dari urutan basa penyandi (gen) yang akan ditranskripsi. Tempat ini dinamakan promoter. Inisiasi Setelah mengalami pengikatan oleh promoter, RNA polimerase akan terikat pada suatu tempat di dekat promoter, yang dinamakan tempat awal polimerisasi atau tapak inisiasi (initiation site). Tempat ini sering dinyatakan sebagai posisi +1 untuk gen yang akan ditranskripsi. Nukleosida trifosfat pertama akan diletakkan di tapak inisiasi dan sintesis RNA pun segera dimulai.

49 Elongasi Pengikatan enzim RNA polimerase beserta kofaktor-kofaktornya pada untai DNA cetakan membentuk kompleks transkripsi. Selama sintesis RNA berlangsung kompleks transkripsi akan bergeser di sepanjang molekul DNA cetakan sehingga nukleotida demi nukleotida akan ditambahkan kepada untai RNA yang sedang diperpanjang pada ujung 3 nya. Jadi, elongasi atau polimerisasi RNA berlangsung dari arah 5 ke 3, sementara RNA polimerasenya sendiri bergerak dari arah 3 ke 5 di sepanjang untai DNA cetakan. Terminasi Berakhirnya polimerisasi RNA ditandai oleh disosiasi kompleks transkripsi atau terlepasnya enzim RNA polimerase beserta kofaktor-kofaktornya dari untai DNA cetakan. Begitu pula halnya dengan molekul RNA hasil sintesis. Hal ini terjadi ketika RNA polimerase mencapai urutan basa tertentu yang disebut dengan terminator. Terminasi transkripsi dapat terjadi oleh dua macam sebab, yaitu terminasi yang hanya bergantung kepada urutan basa cetakan (disebut terminasi diri) dan terminasi yang memerlukan kehadiran suatu protein khusus (protein rho). Di antara keduanya terminasi diri lebih umum dijumpai. Terminasi diri terjadi pada urutan basa palindrom yang diikuti oleh beberapa adenin (A). Urutan palindrom adalah urutan yang sama jika dibaca dari dua arah yang berlawanan. Oleh karena urutan palindom ini biasanya diselingi oleh beberapa basa tertentu, maka molekul RNA yang dihasilkan akan mempunyai ujung terminasi berbentuk batang dan kala (loop) seperti pada Gambar 5.1. Inisiasi transkripsi tidak harus menunggu selesainya transkripsi sebelumnya. Hal ini karena begitu RNA polimerase telah melakukan pemanjangan 50 hingga 60 nukleotida, promoter dapat mengikat RNA polimerase yang lain. Pada gen-gen yang ditranskripsi dengan cepat reinisiasi transkripsi dapat terjadi berulang-ulang sehingga gen tersebut akan terselubungi oleh sejumlah molekul RNA dengan tingkat penyelesaian yang berbeda-beda. Transkripsi pada Prokariot Telah dikatakan di atas bahwa transkripsi merupakan proses sintesis RNA yang dikatalisis oleh enzim RNA polimerase. Berikut ini akan diuraikan sekilas enzim RNA

50 polimerase pada prokariot, khususnya pada bakteri E.coli, promoter 70, serta proses transkripsi pada organisme tersebut. urutan penyela 5 3 ATTAAAGGCTCCTTTTGGAGCCTTTTTTTT T A A T T T C C G A G GA AA A C C T C G G A A AAA A AA 3 5 transkripsi DNA

U U U C C U C G G A A 5 A U U A U G G A G C C U U U 3 U U U U U RNA

Gambar 5.1 Terminasi sintesis RNA menghasilkan ujung berbentuk batang dan kala

RNA polimerase E. coli Enzim RNA polimerase pada E. coli sekurang-kurangnya terdiri atas lima subunit, yaitu alfa (), beta (), beta prima (), omega (), dan sigma (). Pada bentuk lengkapnya, atau disebut sebagai holoenzim, terdapat dua subunit dan satu subunit untuk masing-masing subunit lainnya sehingga sering dituliskan dengan 2. Holoenzim RNA polimerase diperlukan untuk inisiasi transkripsi. Namun, untuk elongasi transkripsi tidak diperlukan faktor sehingga subunit ini dilepaskan dari kompleks

51 transkripsi begitu inisiasi selesai. Sisanya, yakni 2, merupakan enzim inti (core enzyme) yang akan melanjutkan proses transkripsi. Laju sintesis RNA oleh RNA polimerase E. coli dapat mencapai sekitar 40 nukleotida per detik pada suhu 37C. Untuk aktivitasnya enzim ini memerlukan kofaktor Mg2+. Setiap berikatan dengan molekul DNA enzim RNA polimerase E. coli dapat mencakup daerah sepanjang lebih kurang 60pb. Meskipun kebanyakan RNA polimerase seperti halnya yang terdapat pada E. coli mempunyai struktur multisubunit, hal itu bukanlah persyaratan yang mutlak. RNA polimerase pada bakteriofag T3 dan T7, misalnya, merupakan rantai polipeptida tunggal yang ukurannya jauh lebih kecil daripada RNA polimerase bakteri. Enzim tersebut dapat menyintesis RNA dengan cepat, yaitu sebanyak 200 nukleotida per detik pada suhu 37C. Subunit Dua subunit yang identik terdapat pada RNA polimerase inti. Kedua-duanya disandi oleh gen rpoA. Ketika bakteriofag T4 menginfeksi E.coli, subunit akan dimodifikasi melalui ribosilasi ADP suatu arginin. Hal ini berkaitan dengan berkurangnya afinitas pengikatan promoter sehingga subunit diduga kuat memegang peranan dalam pengenalan promoter. Subunit Seperti halnya subunit , subunit juga terdapat pada RNA polimerase inti. Subunit ini diduga sebagai pusat katalitik RNA polimerase, yang dibuktikan melalui hasil penelitian mengenai penghambatan transkripsi menggunakan antibiotik. Antibiotik rifampisin merupakan inhibitor potensial bagi RNA polimerase yang menghalangi inisiasi tetapi tidak mempengaruhi elongasi. Kelompok antibiotik ini tidak menghambat polimerase eukariot sehingga sering digunakan untuk mengatasi infeksi bakteri Gram positif dan tuberkulosis. Rifampisin telah dibuktikan berikatan dengan subunit , dan mutasi-mutasi yang menyebabkan resistensi terhadap rifampisin telah dipetakan pada gen rpoB, yaitu gen yang menyandi subunit . Selanjutnya, kelompok antibiotik yang lain, yakni streptolidigin, ternyata menghambat elongasi transkripsi, dan mutasi-mutasi yang menyebabkan resistesi terhadap antibiotik ini juga dipetakan pada gen rpoB. Kedua hasil

52 penelitian tersebut mendukung pendapat bahwa subunit diduga mempunyai dua domain yang bertanggung jawab terhadap inisiasi dan elongasi transkripsi. Subunit Subunit juga terdapat pada RNA polimerase inti. Subunit yang disandi oleh gen rpoC ini mengikat dua ion Zn2+ yang diduga berpartisipasi dalam fungsi katalitik polimerase. Suatu polianion, yakni heparin, terbukti mengikat subunit . Heparin menghambat transkripsi secara in vitro dan juga berkompetisi dengan DNA dalam pengikatan RNA polimerase. Hal ini mendukung pendapat bahwa subunit diduga bertanggung jawa